ID: 1089869042

View in Genome Browser
Species Human (GRCh38)
Location 11:121656210-121656232
Sequence AAGCAGGGCCCTTTTACTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089869034_1089869042 -1 Left 1089869034 11:121656188-121656210 CCTCTGCCGCTGGCCAGCCCCAA No data
Right 1089869042 11:121656210-121656232 AAGCAGGGCCCTTTTACTTTCGG No data
1089869031_1089869042 9 Left 1089869031 11:121656178-121656200 CCCGAGCTGGCCTCTGCCGCTGG No data
Right 1089869042 11:121656210-121656232 AAGCAGGGCCCTTTTACTTTCGG No data
1089869035_1089869042 -7 Left 1089869035 11:121656194-121656216 CCGCTGGCCAGCCCCAAAGCAGG No data
Right 1089869042 11:121656210-121656232 AAGCAGGGCCCTTTTACTTTCGG No data
1089869033_1089869042 8 Left 1089869033 11:121656179-121656201 CCGAGCTGGCCTCTGCCGCTGGC No data
Right 1089869042 11:121656210-121656232 AAGCAGGGCCCTTTTACTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089869042 Original CRISPR AAGCAGGGCCCTTTTACTTT CGG Intergenic
No off target data available for this crispr