ID: 1089871183

View in Genome Browser
Species Human (GRCh38)
Location 11:121673749-121673771
Sequence GACCTAAGTCTTCTGTACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089871183_1089871192 22 Left 1089871183 11:121673749-121673771 CCATGGTACAGAAGACTTAGGTC No data
Right 1089871192 11:121673794-121673816 GGAGAAAGAGATGGCCAGGTAGG No data
1089871183_1089871190 13 Left 1089871183 11:121673749-121673771 CCATGGTACAGAAGACTTAGGTC No data
Right 1089871190 11:121673785-121673807 GGCAGTTTTGGAGAAAGAGATGG No data
1089871183_1089871191 18 Left 1089871183 11:121673749-121673771 CCATGGTACAGAAGACTTAGGTC No data
Right 1089871191 11:121673790-121673812 TTTTGGAGAAAGAGATGGCCAGG No data
1089871183_1089871184 -10 Left 1089871183 11:121673749-121673771 CCATGGTACAGAAGACTTAGGTC No data
Right 1089871184 11:121673762-121673784 GACTTAGGTCACCTAGCCTGAGG No data
1089871183_1089871193 27 Left 1089871183 11:121673749-121673771 CCATGGTACAGAAGACTTAGGTC No data
Right 1089871193 11:121673799-121673821 AAGAGATGGCCAGGTAGGCTAGG No data
1089871183_1089871188 1 Left 1089871183 11:121673749-121673771 CCATGGTACAGAAGACTTAGGTC No data
Right 1089871188 11:121673773-121673795 CCTAGCCTGAGGGGCAGTTTTGG No data
1089871183_1089871186 -8 Left 1089871183 11:121673749-121673771 CCATGGTACAGAAGACTTAGGTC No data
Right 1089871186 11:121673764-121673786 CTTAGGTCACCTAGCCTGAGGGG No data
1089871183_1089871185 -9 Left 1089871183 11:121673749-121673771 CCATGGTACAGAAGACTTAGGTC No data
Right 1089871185 11:121673763-121673785 ACTTAGGTCACCTAGCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089871183 Original CRISPR GACCTAAGTCTTCTGTACCA TGG (reversed) Intergenic
No off target data available for this crispr