ID: 1089880097

View in Genome Browser
Species Human (GRCh38)
Location 11:121765408-121765430
Sequence AGGGGGACACACTTGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089880097_1089880108 28 Left 1089880097 11:121765408-121765430 CCCTCCTGCAAGTGTGTCCCCCT No data
Right 1089880108 11:121765459-121765481 CTGAGTATTTATATATTCTGGGG No data
1089880097_1089880105 26 Left 1089880097 11:121765408-121765430 CCCTCCTGCAAGTGTGTCCCCCT No data
Right 1089880105 11:121765457-121765479 GCCTGAGTATTTATATATTCTGG No data
1089880097_1089880107 27 Left 1089880097 11:121765408-121765430 CCCTCCTGCAAGTGTGTCCCCCT No data
Right 1089880107 11:121765458-121765480 CCTGAGTATTTATATATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089880097 Original CRISPR AGGGGGACACACTTGCAGGA GGG (reversed) Intergenic
No off target data available for this crispr