ID: 1089884642

View in Genome Browser
Species Human (GRCh38)
Location 11:121808061-121808083
Sequence GGATTCAACAAGTGAAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089884642_1089884648 17 Left 1089884642 11:121808061-121808083 CCTTACTTTCACTTGTTGAATCC No data
Right 1089884648 11:121808101-121808123 ATTTCAGGTAGAAATATGATTGG No data
1089884642_1089884643 -6 Left 1089884642 11:121808061-121808083 CCTTACTTTCACTTGTTGAATCC No data
Right 1089884643 11:121808078-121808100 GAATCCCCTTCACAGTATATAGG No data
1089884642_1089884647 2 Left 1089884642 11:121808061-121808083 CCTTACTTTCACTTGTTGAATCC No data
Right 1089884647 11:121808086-121808108 TTCACAGTATATAGGATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089884642 Original CRISPR GGATTCAACAAGTGAAAGTA AGG (reversed) Intergenic
No off target data available for this crispr