ID: 1089891026

View in Genome Browser
Species Human (GRCh38)
Location 11:121880864-121880886
Sequence CTGCTGGGATAAAGGGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089891021_1089891026 -3 Left 1089891021 11:121880844-121880866 CCTTATTTCTCAAGGTCGTACTG No data
Right 1089891026 11:121880864-121880886 CTGCTGGGATAAAGGGCAACTGG No data
1089891020_1089891026 -2 Left 1089891020 11:121880843-121880865 CCCTTATTTCTCAAGGTCGTACT No data
Right 1089891026 11:121880864-121880886 CTGCTGGGATAAAGGGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089891026 Original CRISPR CTGCTGGGATAAAGGGCAAC TGG Intergenic
No off target data available for this crispr