ID: 1089891089

View in Genome Browser
Species Human (GRCh38)
Location 11:121881708-121881730
Sequence GCTTAAGTATTTTCAAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089891085_1089891089 13 Left 1089891085 11:121881672-121881694 CCAGTGTCATGAACCTCTGGTAC No data
Right 1089891089 11:121881708-121881730 GCTTAAGTATTTTCAAGAAAGGG No data
1089891086_1089891089 0 Left 1089891086 11:121881685-121881707 CCTCTGGTACACTCTCTACCTAT No data
Right 1089891089 11:121881708-121881730 GCTTAAGTATTTTCAAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089891089 Original CRISPR GCTTAAGTATTTTCAAGAAA GGG Intergenic
No off target data available for this crispr