ID: 1089892606

View in Genome Browser
Species Human (GRCh38)
Location 11:121896499-121896521
Sequence CCCAAGTCTCCAGACAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089892606_1089892609 -9 Left 1089892606 11:121896499-121896521 CCATTCCTGTCTGGAGACTTGGG No data
Right 1089892609 11:121896513-121896535 AGACTTGGGTCTTTTTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089892606 Original CRISPR CCCAAGTCTCCAGACAGGAA TGG (reversed) Intergenic
No off target data available for this crispr