ID: 1089900928

View in Genome Browser
Species Human (GRCh38)
Location 11:121984061-121984083
Sequence AATCTGTTCCTGAGGCTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089900923_1089900928 22 Left 1089900923 11:121984016-121984038 CCGTTTTTCACCTATCAGATTGT No data
Right 1089900928 11:121984061-121984083 AATCTGTTCCTGAGGCTACAGGG No data
1089900924_1089900928 12 Left 1089900924 11:121984026-121984048 CCTATCAGATTGTTACATATCCA No data
Right 1089900928 11:121984061-121984083 AATCTGTTCCTGAGGCTACAGGG No data
1089900925_1089900928 -8 Left 1089900925 11:121984046-121984068 CCAAAAGTATGATACAATCTGTT No data
Right 1089900928 11:121984061-121984083 AATCTGTTCCTGAGGCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089900928 Original CRISPR AATCTGTTCCTGAGGCTACA GGG Intergenic
No off target data available for this crispr