ID: 1089902039

View in Genome Browser
Species Human (GRCh38)
Location 11:121996589-121996611
Sequence TTGATTATGTAGTTCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089902039_1089902045 25 Left 1089902039 11:121996589-121996611 CCCTCCATGAACTACATAATCAA No data
Right 1089902045 11:121996637-121996659 TTCTATATTAATTTGCTTTAGGG No data
1089902039_1089902043 -7 Left 1089902039 11:121996589-121996611 CCCTCCATGAACTACATAATCAA No data
Right 1089902043 11:121996605-121996627 TAATCAAATTATACAGTGGAAGG No data
1089902039_1089902044 24 Left 1089902039 11:121996589-121996611 CCCTCCATGAACTACATAATCAA No data
Right 1089902044 11:121996636-121996658 TTTCTATATTAATTTGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089902039 Original CRISPR TTGATTATGTAGTTCATGGA GGG (reversed) Intergenic
No off target data available for this crispr