ID: 1089902255

View in Genome Browser
Species Human (GRCh38)
Location 11:121999384-121999406
Sequence ATGCCTTTCAAGAAAAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089902254_1089902255 -8 Left 1089902254 11:121999369-121999391 CCAAATGGAATTTACATGCCTTT No data
Right 1089902255 11:121999384-121999406 ATGCCTTTCAAGAAAAGAGAAGG No data
1089902251_1089902255 11 Left 1089902251 11:121999350-121999372 CCAAGTTCAAAATATCTTCCCAA No data
Right 1089902255 11:121999384-121999406 ATGCCTTTCAAGAAAAGAGAAGG No data
1089902253_1089902255 -7 Left 1089902253 11:121999368-121999390 CCCAAATGGAATTTACATGCCTT No data
Right 1089902255 11:121999384-121999406 ATGCCTTTCAAGAAAAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089902255 Original CRISPR ATGCCTTTCAAGAAAAGAGA AGG Intergenic
No off target data available for this crispr