ID: 1089903604

View in Genome Browser
Species Human (GRCh38)
Location 11:122013580-122013602
Sequence GTTAATCTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089903604_1089903606 5 Left 1089903604 11:122013580-122013602 CCTGCCATCTTCTGCAGATTAAC No data
Right 1089903606 11:122013608-122013630 TCATTTTGAGAGACAGCTCTTGG No data
1089903604_1089903609 23 Left 1089903604 11:122013580-122013602 CCTGCCATCTTCTGCAGATTAAC No data
Right 1089903609 11:122013626-122013648 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
1089903604_1089903610 26 Left 1089903604 11:122013580-122013602 CCTGCCATCTTCTGCAGATTAAC No data
Right 1089903610 11:122013629-122013651 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218
1089903604_1089903607 16 Left 1089903604 11:122013580-122013602 CCTGCCATCTTCTGCAGATTAAC No data
Right 1089903607 11:122013619-122013641 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
1089903604_1089903608 17 Left 1089903604 11:122013580-122013602 CCTGCCATCTTCTGCAGATTAAC No data
Right 1089903608 11:122013620-122013642 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089903604 Original CRISPR GTTAATCTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr