ID: 1089906583

View in Genome Browser
Species Human (GRCh38)
Location 11:122046386-122046408
Sequence GAATATGCACAGTGTACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089906580_1089906583 24 Left 1089906580 11:122046339-122046361 CCACAAGGGAGCAGGTAATGTTA No data
Right 1089906583 11:122046386-122046408 GAATATGCACAGTGTACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089906583 Original CRISPR GAATATGCACAGTGTACTCT GGG Intergenic
No off target data available for this crispr