ID: 1089908355

View in Genome Browser
Species Human (GRCh38)
Location 11:122069369-122069391
Sequence TAAGAGTTGAATAATGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089908350_1089908355 -3 Left 1089908350 11:122069349-122069371 CCCACTGGATACAGCCATTGTAA No data
Right 1089908355 11:122069369-122069391 TAAGAGTTGAATAATGAGGTGGG No data
1089908348_1089908355 23 Left 1089908348 11:122069323-122069345 CCACAGAGAAAAGTTGTTTAAAA No data
Right 1089908355 11:122069369-122069391 TAAGAGTTGAATAATGAGGTGGG No data
1089908351_1089908355 -4 Left 1089908351 11:122069350-122069372 CCACTGGATACAGCCATTGTAAG No data
Right 1089908355 11:122069369-122069391 TAAGAGTTGAATAATGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089908355 Original CRISPR TAAGAGTTGAATAATGAGGT GGG Intergenic
No off target data available for this crispr