ID: 1089912414

View in Genome Browser
Species Human (GRCh38)
Location 11:122114900-122114922
Sequence GTGAGTAGAACTAAATCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089912414_1089912416 8 Left 1089912414 11:122114900-122114922 CCCACAGATTTAGTTCTACTCAC No data
Right 1089912416 11:122114931-122114953 CAGAGTTCATAAAAGATTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089912414 Original CRISPR GTGAGTAGAACTAAATCTGT GGG (reversed) Intergenic
No off target data available for this crispr