ID: 1089912465

View in Genome Browser
Species Human (GRCh38)
Location 11:122115675-122115697
Sequence GCCATGAAGCGGAATGTTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089912465_1089912470 25 Left 1089912465 11:122115675-122115697 CCAGGAACATTCCGCTTCATGGC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1089912470 11:122115723-122115745 AGAGAAAGCACTGTTTCCTTAGG 0: 1
1: 0
2: 2
3: 39
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089912465 Original CRISPR GCCATGAAGCGGAATGTTCC TGG (reversed) Exonic
905227241 1:36487237-36487259 GCCAGGAGGCGGAAAGTTCAGGG - Intergenic
911201123 1:95044511-95044533 GCCATAGAGAGGAATATTCCTGG - Intronic
911525866 1:98984482-98984504 GCCATTATGTAGAATGTTCCAGG + Intronic
913236456 1:116788458-116788480 GCCATGAACCGGTCTGGTCCTGG - Intergenic
916029541 1:160863851-160863873 GCCTTGAAGCACAGTGTTCCAGG - Intergenic
919328183 1:196135844-196135866 GGCATGAAGTGGAAGCTTCCAGG + Intergenic
921473562 1:215577693-215577715 GGCATGAAGCAGAATTTTACGGG + Exonic
923521440 1:234737968-234737990 GCCTTGAAGCTGACAGTTCCCGG - Intergenic
924337793 1:243000585-243000607 GCCATTCACCTGAATGTTCCAGG + Intergenic
1063373679 10:5538796-5538818 GCCCTCCAGGGGAATGTTCCAGG + Intergenic
1067558090 10:47286117-47286139 GCCATGGAGCTGAAGGTTCATGG - Intergenic
1068500441 10:57835951-57835973 GCCAGGAAGTGGACTCTTCCTGG + Intergenic
1072593591 10:96850247-96850269 GTCATGAAGCGGAAAGATCAAGG + Intronic
1075353209 10:121744940-121744962 GCCATGAAGTCCAACGTTCCAGG - Intronic
1078436511 11:11330078-11330100 GACATGAAGCTCAATGATCCAGG + Intronic
1088691043 11:112328224-112328246 GCCATGAATCGGTCTGGTCCTGG + Intergenic
1089912465 11:122115675-122115697 GCCATGAAGCGGAATGTTCCTGG - Exonic
1091829027 12:3536192-3536214 CCCATGTAGCTGAATGTTCAGGG + Intronic
1092987721 12:13862796-13862818 GCCATGCAGAGGAATGTTTGGGG - Intronic
1094500407 12:31016194-31016216 GCTATGAATCTGACTGTTCCAGG - Intergenic
1094737746 12:33254273-33254295 GCCAGGAAGCAGAAACTTCCTGG - Intergenic
1095372278 12:41483057-41483079 GTCATGAAGTGGAATTTTTCAGG + Intronic
1100695537 12:97088884-97088906 GCCAGGAAGAGGAGTGTTCTGGG - Intergenic
1101118449 12:101554478-101554500 GGCATGAAGAAGAATGCTCCAGG - Intergenic
1102824213 12:115933634-115933656 GAGATGAAGAGGAAAGTTCCAGG - Intergenic
1108497165 13:51036326-51036348 TCCATGAAGCTGTTTGTTCCAGG + Intergenic
1122695907 14:103551967-103551989 GACATGAAGAGGAATCTTCCTGG - Intergenic
1124367089 15:29079736-29079758 GCCCTGAAGGGAAATGTTCCTGG + Intronic
1128425861 15:67542251-67542273 GCCATGAATCTGAATGTTCGTGG - Intergenic
1131520769 15:93112862-93112884 GCCCTGAAACGGAATTTTCCAGG - Intergenic
1132588741 16:717247-717269 CCCATGAAGAGGAAGGTGCCTGG - Exonic
1133390818 16:5408533-5408555 GCCATCCAGAGGAATGGTCCAGG - Intergenic
1144015190 17:11188495-11188517 GACATGTAGTGGAATGTTCACGG + Intergenic
1148044206 17:44732484-44732506 GACATGAAACGGCATGTTCTAGG - Intronic
1152526134 17:80889264-80889286 GCCATGAAGGAGCAGGTTCCAGG + Intronic
926475910 2:13322189-13322211 TCCATGAAGCTGAACATTCCTGG - Intergenic
926656920 2:15417660-15417682 GGGATGGAGCGGAATATTCCTGG - Exonic
932479211 2:72028580-72028602 CCCAGGCAGCGGGATGTTCCTGG + Intergenic
932644875 2:73489701-73489723 GCCATGAAAAGGGATGTTTCCGG + Exonic
933493436 2:83017897-83017919 GCCATGTAGCATCATGTTCCAGG - Intergenic
937332106 2:121038165-121038187 GCCATGAAGCGGGAGGGTCCTGG + Intergenic
937759968 2:125589415-125589437 GCCATGAAGTGTAAGCTTCCAGG - Intergenic
938341476 2:130539366-130539388 GGGATGAAGCGGCATCTTCCAGG - Exonic
938348354 2:130581343-130581365 GGGATGAAGCGGCATCTTCCAGG + Intronic
940456164 2:153903495-153903517 TCAATGAAGCAGAATGGTCCTGG - Intronic
941670648 2:168288865-168288887 GCATTGAAGAGGAATGTCCCTGG + Intergenic
944083181 2:195813112-195813134 GCCATGTACAGGAATGTTCAAGG + Intronic
1173596422 20:44261351-44261373 GCCCTGAAGCTGAATGATCTGGG + Intronic
1181830547 22:25557070-25557092 GCCTTGAAGGAGAGTGTTCCAGG + Intergenic
1183052431 22:35274615-35274637 GCCATGAACAGGTATGTCCCGGG - Intronic
1184362381 22:44026080-44026102 GCAAGGAACCGGAATGTTCTGGG + Intronic
954993941 3:54864998-54865020 GTCATGAAGGTGAATGTTTCTGG - Intronic
967613548 3:191537406-191537428 GCCATGCATTGGAATGTTGCGGG - Intergenic
968560305 4:1277172-1277194 GCCATGAAAAGGAATGTCCATGG + Intergenic
973119238 4:46498610-46498632 GCCATAAATGGGAATGTTCCAGG - Intergenic
976466691 4:85377492-85377514 GGCATAAAGCAGAATTTTCCTGG + Intergenic
986465314 5:8015170-8015192 GGCATGAAGATGACTGTTCCTGG + Intergenic
995016051 5:107309995-107310017 ACCATGGGGCAGAATGTTCCAGG - Intergenic
999150925 5:149425384-149425406 ACCAGGAAGGGGATTGTTCCAGG - Intergenic
1001395514 5:171416993-171417015 GCCATGCAAAGGAATATTCCAGG - Intergenic
1006450351 6:34102415-34102437 GCCCTGAGGCGGAGTGTGCCTGG - Intronic
1010799780 6:80162131-80162153 GCCATCATGCTGCATGTTCCGGG + Intronic
1013741312 6:113289689-113289711 TCCATGAAGAGGAATATTCTAGG - Intergenic
1015192285 6:130484579-130484601 CCCAGGAAGCAGAATGTCCCAGG - Intergenic
1017602353 6:156097573-156097595 GCAATGAATTGGAAAGTTCCAGG + Intergenic
1019373001 7:673128-673150 GCCCTGAAGCGGGAGGTCCCTGG - Intronic
1024775717 7:52783252-52783274 GCAATGAAGACAAATGTTCCAGG + Intergenic
1025922324 7:65925044-65925066 GCCATGAAGAAGAGTGTTCAGGG - Intronic
1028052701 7:86206430-86206452 GCAAGGAAGCGGAAGGTGCCTGG + Intergenic
1032778474 7:135141167-135141189 GCCATGAATCTGTATGGTCCAGG + Intronic
1034944446 7:155253070-155253092 GCCAAGGGGCGGGATGTTCCAGG + Intergenic
1036011826 8:4734193-4734215 ACCATGCAGGGGAATTTTCCAGG - Intronic
1043461760 8:80467623-80467645 GCCATGATTTGGAAGGTTCCTGG + Intergenic
1047784356 8:128139315-128139337 GCCATGGAGTGGAAGGTTACGGG - Intergenic
1059339761 9:113591141-113591163 GCCATGAAGTGGAATCGGCCTGG - Intronic
1186082002 X:5943298-5943320 GCCATCAACCCAAATGTTCCTGG + Intronic
1186265106 X:7824069-7824091 AGCATGAAGAGCAATGTTCCTGG - Intergenic
1190224235 X:48533313-48533335 GCCAATAAGCTGAATGATCCAGG - Intergenic
1191703501 X:64068157-64068179 GCCATGAACCTGTCTGTTCCTGG + Intergenic
1192239872 X:69320412-69320434 GCCAGGAAGGGGAGTTTTCCTGG - Intergenic
1193014576 X:76718092-76718114 GCCATGGAACAGAATGTTTCAGG - Intergenic
1202387080 Y:24336514-24336536 GCCATTCACCTGAATGTTCCAGG - Intergenic
1202483706 Y:25333614-25333636 GCCATTCACCTGAATGTTCCAGG + Intergenic