ID: 1089914806

View in Genome Browser
Species Human (GRCh38)
Location 11:122143257-122143279
Sequence GAGGGTAAGAAATCTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089914806_1089914808 -8 Left 1089914806 11:122143257-122143279 CCATCCTCAGATTTCTTACCCTC No data
Right 1089914808 11:122143272-122143294 TTACCCTCAGCTTAAGTACTTGG No data
1089914806_1089914811 0 Left 1089914806 11:122143257-122143279 CCATCCTCAGATTTCTTACCCTC No data
Right 1089914811 11:122143280-122143302 AGCTTAAGTACTTGGACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089914806 Original CRISPR GAGGGTAAGAAATCTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr