ID: 1089917275

View in Genome Browser
Species Human (GRCh38)
Location 11:122170225-122170247
Sequence TCCTATTTCTGGAGGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089917275_1089917280 17 Left 1089917275 11:122170225-122170247 CCTCCCAGCCTCCAGAAATAGGA No data
Right 1089917280 11:122170265-122170287 TTTACAAACTACCCAGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089917275 Original CRISPR TCCTATTTCTGGAGGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr