ID: 1089918514

View in Genome Browser
Species Human (GRCh38)
Location 11:122183976-122183998
Sequence TAGGGTAGTAATGCTGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089918514_1089918520 0 Left 1089918514 11:122183976-122183998 CCCCAAGCAGCATTACTACCCTA No data
Right 1089918520 11:122183999-122184021 AATATGCCTGTTACTATGGATGG No data
1089918514_1089918519 -4 Left 1089918514 11:122183976-122183998 CCCCAAGCAGCATTACTACCCTA No data
Right 1089918519 11:122183995-122184017 CCTAAATATGCCTGTTACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089918514 Original CRISPR TAGGGTAGTAATGCTGCTTG GGG (reversed) Intergenic
No off target data available for this crispr