ID: 1089921509

View in Genome Browser
Species Human (GRCh38)
Location 11:122213497-122213519
Sequence CGTTCTCTGATGGTGGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089921502_1089921509 10 Left 1089921502 11:122213464-122213486 CCACGGCTGCACTCTTTGTTTTC No data
Right 1089921509 11:122213497-122213519 CGTTCTCTGATGGTGGTCCAGGG No data
1089921501_1089921509 13 Left 1089921501 11:122213461-122213483 CCGCCACGGCTGCACTCTTTGTT No data
Right 1089921509 11:122213497-122213519 CGTTCTCTGATGGTGGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089921509 Original CRISPR CGTTCTCTGATGGTGGTCCA GGG Intergenic
No off target data available for this crispr