ID: 1089923333

View in Genome Browser
Species Human (GRCh38)
Location 11:122231100-122231122
Sequence CTTAGCTGCTTAGTGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089923333_1089923341 17 Left 1089923333 11:122231100-122231122 CCTCCCATCACTAAGCAGCTAAG No data
Right 1089923341 11:122231140-122231162 CCCTCTGCGCTCCTTCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089923333 Original CRISPR CTTAGCTGCTTAGTGATGGG AGG (reversed) Intergenic