ID: 1089924686

View in Genome Browser
Species Human (GRCh38)
Location 11:122245269-122245291
Sequence ATGGATAATACAGCTTATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089924686_1089924692 4 Left 1089924686 11:122245269-122245291 CCCCCATAAGCTGTATTATCCAT No data
Right 1089924692 11:122245296-122245318 TGTAACCACAGTGTGAGATTGGG No data
1089924686_1089924691 3 Left 1089924686 11:122245269-122245291 CCCCCATAAGCTGTATTATCCAT No data
Right 1089924691 11:122245295-122245317 ATGTAACCACAGTGTGAGATTGG No data
1089924686_1089924694 20 Left 1089924686 11:122245269-122245291 CCCCCATAAGCTGTATTATCCAT No data
Right 1089924694 11:122245312-122245334 GATTGGGAAAACTGAGCCTTTGG No data
1089924686_1089924696 22 Left 1089924686 11:122245269-122245291 CCCCCATAAGCTGTATTATCCAT No data
Right 1089924696 11:122245314-122245336 TTGGGAAAACTGAGCCTTTGGGG No data
1089924686_1089924695 21 Left 1089924686 11:122245269-122245291 CCCCCATAAGCTGTATTATCCAT No data
Right 1089924695 11:122245313-122245335 ATTGGGAAAACTGAGCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089924686 Original CRISPR ATGGATAATACAGCTTATGG GGG (reversed) Intergenic
No off target data available for this crispr