ID: 1089927385

View in Genome Browser
Species Human (GRCh38)
Location 11:122272764-122272786
Sequence TCTTCTCCTACTACAGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089927385_1089927392 24 Left 1089927385 11:122272764-122272786 CCCTGACCTGTAGTAGGAGAAGA No data
Right 1089927392 11:122272811-122272833 AAATGTGTGCAGACAATTCTGGG No data
1089927385_1089927391 23 Left 1089927385 11:122272764-122272786 CCCTGACCTGTAGTAGGAGAAGA No data
Right 1089927391 11:122272810-122272832 GAAATGTGTGCAGACAATTCTGG No data
1089927385_1089927388 0 Left 1089927385 11:122272764-122272786 CCCTGACCTGTAGTAGGAGAAGA No data
Right 1089927388 11:122272787-122272809 TCCGTGTGCTATGTCATCTCAGG No data
1089927385_1089927390 1 Left 1089927385 11:122272764-122272786 CCCTGACCTGTAGTAGGAGAAGA No data
Right 1089927390 11:122272788-122272810 CCGTGTGCTATGTCATCTCAGGG No data
1089927385_1089927393 28 Left 1089927385 11:122272764-122272786 CCCTGACCTGTAGTAGGAGAAGA No data
Right 1089927393 11:122272815-122272837 GTGTGCAGACAATTCTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089927385 Original CRISPR TCTTCTCCTACTACAGGTCA GGG (reversed) Intergenic