ID: 1089927387

View in Genome Browser
Species Human (GRCh38)
Location 11:122272770-122272792
Sequence CACGGATCTTCTCCTACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089927387_1089927394 26 Left 1089927387 11:122272770-122272792 CCTGTAGTAGGAGAAGATCCGTG No data
Right 1089927394 11:122272819-122272841 GCAGACAATTCTGGGAAGGATGG No data
1089927387_1089927391 17 Left 1089927387 11:122272770-122272792 CCTGTAGTAGGAGAAGATCCGTG No data
Right 1089927391 11:122272810-122272832 GAAATGTGTGCAGACAATTCTGG No data
1089927387_1089927393 22 Left 1089927387 11:122272770-122272792 CCTGTAGTAGGAGAAGATCCGTG No data
Right 1089927393 11:122272815-122272837 GTGTGCAGACAATTCTGGGAAGG No data
1089927387_1089927388 -6 Left 1089927387 11:122272770-122272792 CCTGTAGTAGGAGAAGATCCGTG No data
Right 1089927388 11:122272787-122272809 TCCGTGTGCTATGTCATCTCAGG No data
1089927387_1089927392 18 Left 1089927387 11:122272770-122272792 CCTGTAGTAGGAGAAGATCCGTG No data
Right 1089927392 11:122272811-122272833 AAATGTGTGCAGACAATTCTGGG No data
1089927387_1089927390 -5 Left 1089927387 11:122272770-122272792 CCTGTAGTAGGAGAAGATCCGTG No data
Right 1089927390 11:122272788-122272810 CCGTGTGCTATGTCATCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089927387 Original CRISPR CACGGATCTTCTCCTACTAC AGG (reversed) Intergenic
No off target data available for this crispr