ID: 1089927393

View in Genome Browser
Species Human (GRCh38)
Location 11:122272815-122272837
Sequence GTGTGCAGACAATTCTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089927387_1089927393 22 Left 1089927387 11:122272770-122272792 CCTGTAGTAGGAGAAGATCCGTG No data
Right 1089927393 11:122272815-122272837 GTGTGCAGACAATTCTGGGAAGG No data
1089927389_1089927393 4 Left 1089927389 11:122272788-122272810 CCGTGTGCTATGTCATCTCAGGG No data
Right 1089927393 11:122272815-122272837 GTGTGCAGACAATTCTGGGAAGG No data
1089927385_1089927393 28 Left 1089927385 11:122272764-122272786 CCCTGACCTGTAGTAGGAGAAGA No data
Right 1089927393 11:122272815-122272837 GTGTGCAGACAATTCTGGGAAGG No data
1089927386_1089927393 27 Left 1089927386 11:122272765-122272787 CCTGACCTGTAGTAGGAGAAGAT No data
Right 1089927393 11:122272815-122272837 GTGTGCAGACAATTCTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089927393 Original CRISPR GTGTGCAGACAATTCTGGGA AGG Intergenic