ID: 1089927394

View in Genome Browser
Species Human (GRCh38)
Location 11:122272819-122272841
Sequence GCAGACAATTCTGGGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089927387_1089927394 26 Left 1089927387 11:122272770-122272792 CCTGTAGTAGGAGAAGATCCGTG No data
Right 1089927394 11:122272819-122272841 GCAGACAATTCTGGGAAGGATGG No data
1089927389_1089927394 8 Left 1089927389 11:122272788-122272810 CCGTGTGCTATGTCATCTCAGGG No data
Right 1089927394 11:122272819-122272841 GCAGACAATTCTGGGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089927394 Original CRISPR GCAGACAATTCTGGGAAGGA TGG Intergenic