ID: 1089929534

View in Genome Browser
Species Human (GRCh38)
Location 11:122296405-122296427
Sequence GCCAATGTTTAACACTTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089929532_1089929534 -2 Left 1089929532 11:122296384-122296406 CCTTGCCTCTGGTTTTCTGTTGC No data
Right 1089929534 11:122296405-122296427 GCCAATGTTTAACACTTCTATGG No data
1089929533_1089929534 -7 Left 1089929533 11:122296389-122296411 CCTCTGGTTTTCTGTTGCCAATG No data
Right 1089929534 11:122296405-122296427 GCCAATGTTTAACACTTCTATGG No data
1089929529_1089929534 16 Left 1089929529 11:122296366-122296388 CCAGACAATACAGATCTCCCTTG No data
Right 1089929534 11:122296405-122296427 GCCAATGTTTAACACTTCTATGG No data
1089929531_1089929534 -1 Left 1089929531 11:122296383-122296405 CCCTTGCCTCTGGTTTTCTGTTG No data
Right 1089929534 11:122296405-122296427 GCCAATGTTTAACACTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089929534 Original CRISPR GCCAATGTTTAACACTTCTA TGG Intergenic