ID: 1089935870

View in Genome Browser
Species Human (GRCh38)
Location 11:122363460-122363482
Sequence CTGTAAGACCAAATGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089935870_1089935875 6 Left 1089935870 11:122363460-122363482 CCTCCTTCCATTTGGTCTTACAG No data
Right 1089935875 11:122363489-122363511 GACTGTGCACTTACAGTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089935870 Original CRISPR CTGTAAGACCAAATGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr