ID: 1089944443

View in Genome Browser
Species Human (GRCh38)
Location 11:122453746-122453768
Sequence AAGAGGAAACATAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089944435_1089944443 12 Left 1089944435 11:122453711-122453733 CCCAGACCTGGGCATCAACCCAG No data
Right 1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG No data
1089944431_1089944443 25 Left 1089944431 11:122453698-122453720 CCATTCTCCTCTTCCCAGACCTG No data
Right 1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG No data
1089944434_1089944443 18 Left 1089944434 11:122453705-122453727 CCTCTTCCCAGACCTGGGCATCA No data
Right 1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG No data
1089944441_1089944443 -7 Left 1089944441 11:122453730-122453752 CCAGGAAAAGTACACAAAGAGGA No data
Right 1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG No data
1089944438_1089944443 6 Left 1089944438 11:122453717-122453739 CCTGGGCATCAACCCAGGAAAAG No data
Right 1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG No data
1089944436_1089944443 11 Left 1089944436 11:122453712-122453734 CCAGACCTGGGCATCAACCCAGG No data
Right 1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG No data
1089944439_1089944443 -6 Left 1089944439 11:122453729-122453751 CCCAGGAAAAGTACACAAAGAGG No data
Right 1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089944443 Original CRISPR AAGAGGAAACATAATGAGGA AGG Intergenic
No off target data available for this crispr