ID: 1089947372

View in Genome Browser
Species Human (GRCh38)
Location 11:122490868-122490890
Sequence CGTGCATAAGAATCATCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089947369_1089947372 15 Left 1089947369 11:122490830-122490852 CCATATAAACATTTATACCAGTA No data
Right 1089947372 11:122490868-122490890 CGTGCATAAGAATCATCTGGAGG No data
1089947367_1089947372 30 Left 1089947367 11:122490815-122490837 CCTCTTCTATGTTTCCCATATAA No data
Right 1089947372 11:122490868-122490890 CGTGCATAAGAATCATCTGGAGG No data
1089947368_1089947372 16 Left 1089947368 11:122490829-122490851 CCCATATAAACATTTATACCAGT No data
Right 1089947372 11:122490868-122490890 CGTGCATAAGAATCATCTGGAGG No data
1089947370_1089947372 -2 Left 1089947370 11:122490847-122490869 CCAGTATTTCTCAAACTTTCACG No data
Right 1089947372 11:122490868-122490890 CGTGCATAAGAATCATCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089947372 Original CRISPR CGTGCATAAGAATCATCTGG AGG Intergenic