ID: 1089963844

View in Genome Browser
Species Human (GRCh38)
Location 11:122639009-122639031
Sequence CTATAAAAATGAAGACAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089963844_1089963845 9 Left 1089963844 11:122639009-122639031 CCATCTTGTCTTCATTTTTATAG No data
Right 1089963845 11:122639041-122639063 AACACCTCATAAGAGCTTGTAGG No data
1089963844_1089963849 28 Left 1089963844 11:122639009-122639031 CCATCTTGTCTTCATTTTTATAG No data
Right 1089963849 11:122639060-122639082 TAGGGGCTCCAGCAATGTAGAGG No data
1089963844_1089963846 10 Left 1089963844 11:122639009-122639031 CCATCTTGTCTTCATTTTTATAG No data
Right 1089963846 11:122639042-122639064 ACACCTCATAAGAGCTTGTAGGG No data
1089963844_1089963847 11 Left 1089963844 11:122639009-122639031 CCATCTTGTCTTCATTTTTATAG No data
Right 1089963847 11:122639043-122639065 CACCTCATAAGAGCTTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089963844 Original CRISPR CTATAAAAATGAAGACAAGA TGG (reversed) Intergenic
No off target data available for this crispr