ID: 1089963848

View in Genome Browser
Species Human (GRCh38)
Location 11:122639045-122639067
Sequence AGCCCCTACAAGCTCTTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089963848_1089963849 -8 Left 1089963848 11:122639045-122639067 CCTCATAAGAGCTTGTAGGGGCT No data
Right 1089963849 11:122639060-122639082 TAGGGGCTCCAGCAATGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089963848 Original CRISPR AGCCCCTACAAGCTCTTATG AGG (reversed) Intergenic
No off target data available for this crispr