ID: 1089963849

View in Genome Browser
Species Human (GRCh38)
Location 11:122639060-122639082
Sequence TAGGGGCTCCAGCAATGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089963848_1089963849 -8 Left 1089963848 11:122639045-122639067 CCTCATAAGAGCTTGTAGGGGCT No data
Right 1089963849 11:122639060-122639082 TAGGGGCTCCAGCAATGTAGAGG No data
1089963844_1089963849 28 Left 1089963844 11:122639009-122639031 CCATCTTGTCTTCATTTTTATAG No data
Right 1089963849 11:122639060-122639082 TAGGGGCTCCAGCAATGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089963849 Original CRISPR TAGGGGCTCCAGCAATGTAG AGG Intergenic
No off target data available for this crispr