ID: 1089964055

View in Genome Browser
Species Human (GRCh38)
Location 11:122640932-122640954
Sequence CTGAATTTTGTATATTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089964047_1089964055 27 Left 1089964047 11:122640882-122640904 CCTCAGCCTCTCGAGTAGCTGAG 0: 222
1: 9363
2: 133096
3: 302743
4: 213253
Right 1089964055 11:122640932-122640954 CTGAATTTTGTATATTTTGGGGG No data
1089964048_1089964055 21 Left 1089964048 11:122640888-122640910 CCTCTCGAGTAGCTGAGACTGTA No data
Right 1089964055 11:122640932-122640954 CTGAATTTTGTATATTTTGGGGG No data
1089964049_1089964055 -10 Left 1089964049 11:122640919-122640941 CCACCATGCCTGTCTGAATTTTG No data
Right 1089964055 11:122640932-122640954 CTGAATTTTGTATATTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089964055 Original CRISPR CTGAATTTTGTATATTTTGG GGG Intergenic
No off target data available for this crispr