ID: 1089964787

View in Genome Browser
Species Human (GRCh38)
Location 11:122647050-122647072
Sequence GTGTGCAAGGTGAGCCTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089964787_1089964790 -10 Left 1089964787 11:122647050-122647072 CCGTCCAGGCTCACCTTGCACAC No data
Right 1089964790 11:122647063-122647085 CCTTGCACACTCAGCCCCAGAGG No data
1089964787_1089964796 12 Left 1089964787 11:122647050-122647072 CCGTCCAGGCTCACCTTGCACAC No data
Right 1089964796 11:122647085-122647107 GCACCCACACACAGTCTGGTGGG No data
1089964787_1089964794 8 Left 1089964787 11:122647050-122647072 CCGTCCAGGCTCACCTTGCACAC No data
Right 1089964794 11:122647081-122647103 AGAGGCACCCACACACAGTCTGG No data
1089964787_1089964795 11 Left 1089964787 11:122647050-122647072 CCGTCCAGGCTCACCTTGCACAC No data
Right 1089964795 11:122647084-122647106 GGCACCCACACACAGTCTGGTGG No data
1089964787_1089964800 16 Left 1089964787 11:122647050-122647072 CCGTCCAGGCTCACCTTGCACAC No data
Right 1089964800 11:122647089-122647111 CCACACACAGTCTGGTGGGAGGG No data
1089964787_1089964798 15 Left 1089964787 11:122647050-122647072 CCGTCCAGGCTCACCTTGCACAC No data
Right 1089964798 11:122647088-122647110 CCCACACACAGTCTGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089964787 Original CRISPR GTGTGCAAGGTGAGCCTGGA CGG (reversed) Intergenic
No off target data available for this crispr