ID: 1089965892

View in Genome Browser
Species Human (GRCh38)
Location 11:122655098-122655120
Sequence CAGGGCAGAAAGAAGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089965892_1089965906 28 Left 1089965892 11:122655098-122655120 CCTTCCCTCTTCTTTCTGCCCTG No data
Right 1089965906 11:122655149-122655171 CTGCCACCTCTGAGAACCTGAGG No data
1089965892_1089965899 3 Left 1089965892 11:122655098-122655120 CCTTCCCTCTTCTTTCTGCCCTG No data
Right 1089965899 11:122655124-122655146 CTCTTTTCTTGTCCCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089965892 Original CRISPR CAGGGCAGAAAGAAGAGGGA AGG (reversed) Intergenic
No off target data available for this crispr