ID: 1089969246

View in Genome Browser
Species Human (GRCh38)
Location 11:122679168-122679190
Sequence CTGGACATGTTGAGGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089969237_1089969246 16 Left 1089969237 11:122679129-122679151 CCACTGGAGCTGAGGTTGGGAAG 0: 1
1: 0
2: 4
3: 45
4: 325
Right 1089969246 11:122679168-122679190 CTGGACATGTTGAGGGTGAAGGG 0: 1
1: 0
2: 1
3: 23
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089969246 Original CRISPR CTGGACATGTTGAGGGTGAA GGG Intronic
900893147 1:5464208-5464230 GTGGACAAGTTGAGGGTCACGGG + Intergenic
901644958 1:10711792-10711814 CTGGAAATGTTGAACGAGAAAGG + Intronic
903217921 1:21853205-21853227 CTGGCCATGTGGAGGCAGAAGGG - Intronic
903447623 1:23432337-23432359 CTGGACAGGTAGATGGGGAATGG - Intronic
904938098 1:34145999-34146021 CTTGGCCTGTTGAGGCTGAATGG - Intronic
905706330 1:40062400-40062422 CTAGGCATGCTGAGGGTCAAGGG - Intronic
906196295 1:43932648-43932670 TTGGACATGTTGAGTTGGAAGGG - Intergenic
911692328 1:100848394-100848416 CTGGACAATTTGAGAGTTAAGGG + Intergenic
912079134 1:105913217-105913239 CTGGACTTATAGAGGGAGAAAGG - Intergenic
912699227 1:111864102-111864124 TTGGTCATGTTGAGGGTGGCTGG + Intronic
917020704 1:170583169-170583191 CTGGACGTGTTGAGAGTGCATGG + Intergenic
918070294 1:181129339-181129361 CTGGTCAGGCTGAGGGTCAAAGG + Intergenic
918575497 1:186054251-186054273 GTGGACATGTGGAGGGGGAAGGG + Intronic
919596996 1:199576745-199576767 CTGGGCATGCTGGGGGTTAACGG - Intergenic
919830408 1:201536894-201536916 ATGGACAGGTTGAGGGAGGAAGG - Intergenic
920725609 1:208432135-208432157 CTGGACAAATTGGGGATGAATGG - Intergenic
921364388 1:214359978-214360000 ATGGACATGGTGAAGGTGAGGGG - Intronic
922759989 1:228122539-228122561 CAGCAAATCTTGAGGGTGAAAGG - Intergenic
924307987 1:242711389-242711411 CTGGAATTGGTGAGGGTGAATGG - Intergenic
1062908152 10:1193053-1193075 GTGGAGGTGTTGAGGGTGGAAGG + Intronic
1063477425 10:6341046-6341068 CTGCTCAGGTGGAGGGTGAAGGG + Intergenic
1066225270 10:33376514-33376536 CAGGTGATGTTGAGGGTGATGGG - Intergenic
1068080820 10:52315103-52315125 CTGGACAGTTTTAGTGTGAAAGG - Intronic
1070333804 10:75437146-75437168 CTGGAGATGTTGAGGGTGTCAGG + Intronic
1070378150 10:75854414-75854436 CTGGATATTTTGAGAGTAAAAGG - Intronic
1070599599 10:77856585-77856607 CTGGACATGAGGTGGGGGAAAGG + Intronic
1070820980 10:79354132-79354154 TTGGACATGGTGATGGTGATGGG + Exonic
1072729270 10:97834227-97834249 CTGGAGATGATGGGGATGAAGGG - Intergenic
1074045576 10:109835577-109835599 CTGGCCAGGGTGAGGTTGAAAGG + Intergenic
1074774648 10:116758286-116758308 CTGGACATGGGCAGAGTGAAAGG - Intergenic
1075191963 10:120317399-120317421 GTGGAAAAGTTGAGGGTGAAGGG - Intergenic
1075317287 10:121462957-121462979 CTGGACATTTTAAGTGTGAAGGG - Intergenic
1075822159 10:125324086-125324108 GTGGACATGTTGAGTTTGAGAGG + Intergenic
1076668219 10:132104794-132104816 TTGGACATGGTGAGGCTGGATGG - Exonic
1077039871 11:515390-515412 CTGGACATCATGAGAATGAAGGG - Intergenic
1077105580 11:841039-841061 CTGGAGGTCTTGAGGGTGACTGG - Intronic
1077541674 11:3149456-3149478 CTGGTCATGTTGATGGGGACAGG - Intronic
1078257610 11:9673435-9673457 CTGAACATGTAGAGGCTTAAAGG - Intronic
1080001970 11:27360608-27360630 CTGGACAGCTTGGGGGTGACAGG - Intronic
1080511443 11:32977020-32977042 CTGAACATGTTAAGAGTAAAAGG - Exonic
1081772088 11:45656282-45656304 CTGGACATGTTAATAATGAAGGG - Intronic
1083146371 11:60762736-60762758 GGGGAGATGTTGAGGGTGCACGG + Intronic
1084730252 11:71068508-71068530 CAGGCCATGTTCAGGGAGAAGGG + Intronic
1084849882 11:71930080-71930102 AAGGAGATGTTGAGTGTGAAAGG + Intronic
1085471099 11:76758651-76758673 CTGCACAGGCTGAGTGTGAAGGG + Intergenic
1085564523 11:77501225-77501247 CTGGCAATGTGGAGGATGAAGGG + Intergenic
1085743910 11:79098808-79098830 CTGGACAATTTCAGTGTGAAAGG + Intronic
1085895574 11:80635565-80635587 TTTGACATGTTGAGGCTGTAAGG - Intergenic
1086613629 11:88787867-88787889 CTGGATATGTTAAGTTTGAAAGG + Intronic
1086685559 11:89730120-89730142 CTGGACTACTTGAGGGTGGAGGG + Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087115523 11:94520554-94520576 CTGGACATCTTAAGGTTGAGAGG - Intergenic
1087209301 11:95430263-95430285 CTGAAAATGTTGAGAGTCAAAGG + Intergenic
1088277284 11:108101232-108101254 CTGGATATATTGAGTGTGAGAGG + Intronic
1089868137 11:121649837-121649859 TTGGAAATGTTGAGTTTGAAGGG + Intergenic
1089969246 11:122679168-122679190 CTGGACATGTTGAGGGTGAAGGG + Intronic
1092192123 12:6528743-6528765 AAGGACATGGTGAAGGTGAAGGG + Exonic
1093702236 12:22234660-22234682 CTGCACATGTTGAGTTTGATTGG - Intronic
1094870556 12:34597060-34597082 CTGCACATGTGCAGGGTGCAGGG + Intergenic
1096596310 12:52697965-52697987 CTGGATGTGTTGAGGGGGTATGG - Intronic
1099760158 12:86911268-86911290 CTGGACGTGTTGAGGGAAAGAGG + Intergenic
1100660893 12:96697647-96697669 GTGGACATGCTGAGGATAAATGG + Intronic
1100724494 12:97394703-97394725 CTGGAGGTTTTGAGGCTGAAGGG - Intergenic
1101242123 12:102848945-102848967 CTGGAGAGGTTGAGAGTAAATGG + Intronic
1102568212 12:113811115-113811137 CGGGACCTGTTGGGGGTGGAGGG - Intergenic
1102974112 12:117193813-117193835 CTGGATAAGTTGAGTTTGAAGGG - Intergenic
1103112176 12:118290159-118290181 CTGTACATGATGAGGATTAAAGG - Intronic
1104058778 12:125250464-125250486 GGGGACACGATGAGGGTGAAAGG - Intronic
1104343850 12:127977833-127977855 CTTGACATTGTGAGTGTGAAGGG + Intergenic
1104628220 12:130377313-130377335 CTGGGCATGTTAAAGTTGAAGGG + Intergenic
1104880575 12:132067919-132067941 CTGTGCATGTTGGTGGTGAAAGG + Intronic
1106009830 13:25809392-25809414 TTGGACATGTTAAGTTTGAAAGG - Intronic
1106099851 13:26684690-26684712 CTGGACCATTTGAGAGTGAATGG - Intronic
1106544406 13:30717738-30717760 CTGAACATGTAGAGGCTGATAGG - Intronic
1107305329 13:39012949-39012971 GTGGACAGGTTGAGGGGGAAAGG + Exonic
1108743776 13:53368038-53368060 CTAGACATATAGAGAGTGAATGG + Intergenic
1109041652 13:57346317-57346339 CTGGACTATTAGAGGGTGAAAGG + Intergenic
1111597355 13:90428397-90428419 CTGGCCATGTTGAAGGAGACAGG + Intergenic
1111882493 13:93975086-93975108 CTGGACATGTTGAATTGGAATGG + Intronic
1113717591 13:112524056-112524078 CTGCAGATGCTGAGGGTGACGGG - Intronic
1114526868 14:23371983-23372005 CTGGACCTGCTGAGGCTGAGTGG + Intergenic
1115397036 14:32920010-32920032 CTGTACATGATGAGGGTGCCAGG + Intergenic
1115860887 14:37684830-37684852 CTGGCCAGGTTGAGGATTAAGGG + Intronic
1116512459 14:45763668-45763690 GTGCATATGTGGAGGGTGAAGGG + Intergenic
1118751131 14:68808528-68808550 GTGGTCATTTTGAGGGTGCAGGG - Intergenic
1119004022 14:70907986-70908008 CTCACCATGTAGAGGGTGAAGGG - Exonic
1121994219 14:98589387-98589409 CTGGACATATTAAGGATGGAGGG + Intergenic
1122151522 14:99728552-99728574 CTGGAAATGGAGAGGGTGGAGGG - Intergenic
1123145932 14:106129909-106129931 CTAGAGATATTGAGTGTGAATGG - Intergenic
1123216134 14:106810812-106810834 CTGGAGATATGGAGTGTGAATGG - Intergenic
1123414191 15:20083185-20083207 CTGGATCTGCTGAGGGGGAAGGG - Intergenic
1123523533 15:21090296-21090318 CTGGATCTGCTGAGGGGGAAGGG - Intergenic
1124792729 15:32744884-32744906 TTGGAGATGTGGAGAGTGAATGG - Exonic
1126636295 15:50783013-50783035 CCAGACATTTTGAGAGTGAAAGG - Intergenic
1129755164 15:78093733-78093755 CTGGAGATGTTGAGGTTTAGTGG - Intronic
1130018646 15:80208394-80208416 CTGCACATGCTGGGGGTGGAAGG + Intergenic
1131686412 15:94772753-94772775 CTGGGCAGGTTCAGGGTGCAAGG - Intergenic
1132484466 16:183278-183300 CTGGAGATGTGGAGGTTGGAGGG + Intergenic
1133842824 16:9425435-9425457 CTATACATTTTAAGGGTGAATGG + Intergenic
1134111621 16:11518563-11518585 CTGGACATGCTGGGGGTCACAGG + Intronic
1134120736 16:11582973-11582995 CTGAAAATGTTCAAGGTGAATGG + Intronic
1135928688 16:26717979-26718001 CAGCTCATGTTGAGGCTGAAGGG + Intergenic
1136693186 16:32051886-32051908 CTAGAGATATTGAGTGTGAATGG + Intergenic
1136793679 16:32995109-32995131 CTAGAGATATTGAGTGTGAATGG + Intergenic
1136876232 16:33859269-33859291 CTAGAGATATTGAGTGTGAATGG - Intergenic
1137825617 16:51492067-51492089 CTGAGCATGTTGAGGCTGCAGGG - Intergenic
1138897142 16:61220513-61220535 CTGTACATGTTGGGGGAGGAGGG + Intergenic
1139459641 16:67111282-67111304 CTGGAAATGGAGAGGGTGAAGGG - Intronic
1140529751 16:75654605-75654627 CAGGACAAGTTGAGGGGGAAAGG + Intronic
1140982384 16:80123383-80123405 AGGGATATGTGGAGGGTGAAAGG - Intergenic
1203095941 16_KI270728v1_random:1256802-1256824 CTAGAGATATTGAGTGTGAATGG + Intergenic
1144264455 17:13554818-13554840 CTAGACTTGTTGGGGGTGGAGGG - Intronic
1145895312 17:28454075-28454097 CTGAACATGTTGAAGGTGCTTGG - Intergenic
1145994984 17:29099934-29099956 CTGGGAAGGTTGAGGGAGAAGGG + Intronic
1147365306 17:39955046-39955068 CTGGCCATGTCCAGGGAGAAGGG + Intergenic
1147970710 17:44218222-44218244 CTGGACAGCTGGAGGATGAACGG - Exonic
1148000144 17:44383058-44383080 CTGGACCTGTTGAGCTTGAAGGG - Intronic
1148878039 17:50704175-50704197 TTGGACATGTTGAGTTTGAGGGG + Intronic
1150837575 17:68578484-68578506 CTGGTCATGCTGAGGAGGAAAGG - Intronic
1151432826 17:74076129-74076151 ATGGCCATGATGATGGTGAATGG + Intergenic
1152435592 17:80274356-80274378 CTGGACATGTTCAAGGAGAATGG + Intronic
1155102927 18:22630974-22630996 GTGGACATCTTGGGGGTGGAGGG + Intergenic
1156776008 18:40789823-40789845 TTGGTCTTGTTAAGGGTGAAGGG + Intergenic
1159004524 18:63000769-63000791 ATGCACATGTTTAGGCTGAAAGG + Intergenic
1159364487 18:67448247-67448269 CTGGACATGTTTTGGTTGATAGG + Intergenic
1160329284 18:77977455-77977477 CTGGACATGTGTAGCGGGAATGG - Intergenic
1160551611 18:79697113-79697135 CTGGCAAGTTTGAGGGTGAAGGG + Intronic
1161224315 19:3136142-3136164 CCCGACAGGTTGACGGTGAAGGG - Intergenic
1162185171 19:8898994-8899016 ATGGTAAAGTTGAGGGTGAACGG + Exonic
1162185596 19:8902180-8902202 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1162185974 19:8905027-8905049 ATGGTGAAGTTGAGGGTGAACGG + Exonic
1162186700 19:8910460-8910482 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1162187310 19:8915597-8915619 ATGGTGAAGTTGAGGGTGAACGG + Exonic
1162188151 19:8923016-8923038 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1165425390 19:35742680-35742702 CTGTCCCTGTTGGGGGTGAAGGG + Exonic
1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG + Exonic
925913183 2:8586652-8586674 CTGGACATCCTGAAGGGGAATGG - Intergenic
931218894 2:60271304-60271326 CTGGGTATGTGGATGGTGAATGG - Intergenic
936727427 2:115337226-115337248 CTGGGCAAGTTGAGGCAGAATGG + Intronic
937474746 2:122205115-122205137 CTGGACGTGTGGAGGGTGGGTGG + Intergenic
939374353 2:141344864-141344886 GTGGGCATCTTGAGGGGGAAGGG - Intronic
940031485 2:149267286-149267308 CTCGAGATGTTGGGGGTGAGAGG - Intergenic
941223358 2:162813145-162813167 TTGGAAATGTTGAAGGTGAGAGG + Intronic
946333556 2:219023479-219023501 CTGGACATGTTGTGGGGGGCTGG - Intronic
946428611 2:219613194-219613216 CTGTACCTGTTGAAGGTGACTGG + Exonic
947116156 2:226773334-226773356 CTGTACTTGTTGACTGTGAAGGG - Intronic
947732978 2:232441227-232441249 CTGGCCATGTTGGGGGAGGAGGG + Intergenic
948664497 2:239526655-239526677 CTGGAGGGGCTGAGGGTGAATGG - Intergenic
1168780651 20:486738-486760 CTGGTCCTGTTGAGGTTTAATGG + Intronic
1169606251 20:7322892-7322914 TTGGACAGGTTGATGGTGAAGGG - Intergenic
1170123751 20:12938872-12938894 CTGAACATGTGGAGGCTGACAGG - Intergenic
1170125327 20:12956801-12956823 CTGAACATGTGGAGGCTGACAGG - Intergenic
1172637503 20:36419871-36419893 CTGCACATGTTAAGGGAGAGGGG + Intronic
1175172079 20:57087825-57087847 CTTGACATGTGGAGGGTAGAAGG - Intergenic
1175570859 20:60020466-60020488 CTGGAAATGTGGGCGGTGAAGGG + Intronic
1177398063 21:20563237-20563259 CTGGACAAGTGGAGGTTGACTGG + Intergenic
1177869795 21:26557698-26557720 CTGGAGATGCTGGGGTTGAAAGG - Intronic
1179331676 21:40408377-40408399 CTGGAAATGTTGAGCTTTAAGGG + Intronic
1179460828 21:41533817-41533839 CTGGGCATGGTGGGGGTGAGGGG + Intergenic
1179633513 21:42692952-42692974 CTGGACATGTGGTGAGGGAATGG - Intronic
1181919017 22:26305441-26305463 CTGGAGATGGTAAGGGTGATGGG - Intronic
1182545931 22:31076383-31076405 CTGGATCTGCTGAGGGGGAAGGG + Intronic
1184800115 22:46753924-46753946 ATGGACATCCTGAGGGTGAGGGG - Intergenic
949422013 3:3875707-3875729 CTTGAAATGTTAAAGGTGAATGG - Intronic
950997324 3:17516858-17516880 CAGAGCATGTTGAGGGAGAAGGG - Intronic
952329936 3:32355582-32355604 ATGGACATGTGGAGGGGAAAGGG - Intronic
953616188 3:44492829-44492851 CTGGACATGTTGCAGGTCAGGGG + Intergenic
953915993 3:46921591-46921613 CTGGGCATGTTGAGGCCGGAGGG - Intergenic
953967688 3:47322612-47322634 CTGGACATTTTGCTGGTCAATGG - Exonic
954397508 3:50300733-50300755 CTGGTCACGTTCAGGATGAAGGG + Exonic
956850599 3:73224817-73224839 CTGGTCATTTTGAGGGTGGGAGG + Intergenic
960926110 3:122795898-122795920 ATGGGGATGTTGAGGATGAAAGG + Intronic
963219500 3:142792266-142792288 CAGGACATTTTGAGAGTGAAAGG + Intronic
965144971 3:164889771-164889793 CTGGACATGTTCTGGGCCAAAGG - Intergenic
965501335 3:169459670-169459692 GGGGACAGGTTGAGGGGGAAGGG - Intronic
968140643 3:196253396-196253418 CTGGACTTGTTTAGGGAAAATGG - Intronic
969039292 4:4282637-4282659 CTGGACCTTCTGAGGCTGAAGGG + Intronic
969875997 4:10135992-10136014 CTGGAGGTGTTGAGGGTTTAGGG + Intergenic
970353508 4:15229606-15229628 CTGAACCTGTAGAGGCTGAAGGG - Intergenic
972814094 4:42624403-42624425 CTAGACATTTTGAAGTTGAATGG + Intronic
973864455 4:55097926-55097948 CAGGACATTTGGAGAGTGAAGGG - Intronic
975353588 4:73373097-73373119 CTGGAAAGGGTGAGGGTGAGAGG + Intergenic
976101177 4:81565575-81565597 ATGGAAATGTTGAGAGAGAAAGG - Intronic
977297941 4:95231673-95231695 CTGGACATGTTTATTTTGAATGG - Intronic
977716664 4:100190585-100190607 CTGGAAGTGTAGAGGTTGAAAGG - Intronic
978562053 4:110043742-110043764 CTCGACAGGTTGAGGTTGCAGGG + Intergenic
978567776 4:110102582-110102604 CTGGAGAGGTTGAGGCTGTAGGG + Intronic
978699134 4:111621915-111621937 CCCCACATGTTGAGGGAGAAAGG - Intergenic
981178814 4:141714974-141714996 CTGGACATGCTGAGTTTGAAAGG - Intronic
982276287 4:153639892-153639914 CTGGACATGTTCCGTGTGAAAGG + Intergenic
982489891 4:156016978-156017000 CAGGACATTTTGAGAGTGAAAGG - Intergenic
982537283 4:156622434-156622456 TTGGGCATGTTGAGTTTGAATGG + Intergenic
982545255 4:156725011-156725033 TCGGACAAGTGGAGGGTGAAAGG - Intergenic
983313750 4:166099355-166099377 CAGGACAGGTTGACTGTGAATGG + Exonic
985502073 5:254570-254592 CTGGCCTTGCTGATGGTGAACGG + Intronic
986512710 5:8525165-8525187 CTGGACATGTGGAGGCCGACAGG + Intergenic
988674067 5:33413257-33413279 CTGGAGGTGTTCAGAGTGAAAGG + Intergenic
989730394 5:44641428-44641450 CTTGCCATGTTGTGGGTGACAGG - Intergenic
989791566 5:45409557-45409579 GTGGACATGTTAAGTGTTAAGGG - Intronic
990322954 5:54647902-54647924 ATGGAGATGTCAAGGGTGAATGG + Intergenic
991217260 5:64170055-64170077 CTTGACAGGTAGAGGATGAAGGG - Intronic
991716636 5:69457011-69457033 CTGGAAATGTTTAGGGTTAATGG - Intergenic
991731050 5:69588613-69588635 CTGGAAATGTTTAGGGTTAATGG - Intronic
991807482 5:70443772-70443794 CTGGAAATGTTTAGGGTTAATGG - Intergenic
991863900 5:71039239-71039261 CTGGAAATGTTTAGGGTTAATGG + Intronic
991960248 5:72037085-72037107 CTGGAGCTGCTGAGGGTGCAGGG - Intergenic
993951759 5:94184201-94184223 CTAGAGATGTTAAGGATGAAAGG + Intronic
995268419 5:110192480-110192502 CAGGACATATGGTGGGTGAATGG - Intergenic
995392709 5:111656589-111656611 CTGGACATGTTTATGATCAATGG - Intergenic
995794980 5:115931527-115931549 TTGGACATGTTGAGTAAGAAAGG + Intergenic
997027326 5:130080820-130080842 GTGAACCTTTTGAGGGTGAAAGG - Intronic
999028780 5:148266520-148266542 CTAGAAATAATGAGGGTGAAGGG + Intergenic
1004308611 6:14523645-14523667 CTGGCCATGGAGAGGGAGAAGGG - Intergenic
1005390945 6:25332579-25332601 AGGGACATGTTGAGGAAGAAGGG + Intronic
1008026325 6:46640218-46640240 CTGTAGATTTTGAGGGAGAAGGG - Intronic
1009497944 6:64374108-64374130 CTGGCCCAGTTCAGGGTGAAGGG + Intronic
1010116845 6:72322844-72322866 CTGGAAATTGTGAGGGTGGAAGG + Intronic
1014684314 6:124477339-124477361 CTGGACATTGGGAGGGAGAAGGG + Intronic
1015525487 6:134171874-134171896 CTGGACTTTTTGAGGGTGACTGG + Intronic
1021022937 7:15626258-15626280 CTGGACATGTAGAGTTTGTATGG + Intronic
1022489568 7:30806245-30806267 CTTGGCATGGTGAGGTTGAAAGG + Intronic
1024751540 7:52471514-52471536 CAAGATATTTTGAGGGTGAATGG + Intergenic
1026212730 7:68321204-68321226 CTGGAGGTGGTGAGGGAGAATGG - Intergenic
1028073299 7:86478986-86479008 CAGGATATGTTTAGGGTGTAGGG + Intergenic
1030927267 7:115474436-115474458 CTGCACATGTACAGGGTGCATGG - Intergenic
1032256025 7:130297705-130297727 AAGGACCTGTTGAGAGTGAATGG - Intronic
1032498688 7:132382524-132382546 CTGTGCATGCTTAGGGTGAAAGG - Intronic
1033997502 7:147369284-147369306 CTGGACATGGTCAGTTTGAAAGG - Intronic
1036434894 8:8723854-8723876 CGGGGCCTGTTGGGGGTGAAGGG + Intergenic
1037739976 8:21600999-21601021 CTGGAAGTGTGGAGGGTGAAGGG - Intergenic
1038355702 8:26827281-26827303 TGGGAAATGTTGAGGTTGAATGG + Intronic
1042481494 8:69308571-69308593 CAGGACAGTTTGAGAGTGAAAGG - Intergenic
1046101892 8:109624223-109624245 TTGGGCATTTTGGGGGTGAAAGG - Intronic
1046233656 8:111392177-111392199 CTGGGCATTTTGTGTGTGAAAGG - Intergenic
1046920560 8:119723771-119723793 CTGGACATGTTAATGATGATTGG + Intergenic
1046980074 8:120327652-120327674 CTGGAAATGTATAGGGTGAGGGG - Intronic
1048370403 8:133771809-133771831 CTGGACATGTTGAGGGTGGGAGG + Intergenic
1053475950 9:38382178-38382200 CTGGACATGTTCATGAGGAACGG - Intergenic
1053628411 9:39902393-39902415 CGGGACCTGTTGGGGGTGGAGGG - Intergenic
1053777648 9:41563934-41563956 CGGGACCTGTTGGGGGTGGAGGG + Intergenic
1054215476 9:62348308-62348330 CGGGACCTGTTGGGGGTGGAGGG + Intergenic
1054672005 9:67807039-67807061 CGGGACCTGTTGGGGGTGGAGGG - Intergenic
1057776158 9:98011673-98011695 CTGGACATGTTGAGAATTGATGG + Intronic
1058459637 9:105170982-105171004 CTGGACATGCTCAGTGTGAAGGG + Intergenic
1060566812 9:124599947-124599969 CTGCAGATTTTGAGGCTGAAGGG + Intronic
1186067100 X:5777908-5777930 GTGCTCATGTTGGGGGTGAAAGG - Intergenic
1186137980 X:6539702-6539724 CTGGACTTGCTGAGGGTGTGTGG - Intergenic
1187616673 X:21002317-21002339 TTGGGCATGTTGAGTGTGATAGG - Intergenic
1191690500 X:63933681-63933703 CTGAACAGCTTGCGGGTGAAAGG - Intergenic
1198715973 X:139558215-139558237 CAGCACATTTGGAGGGTGAATGG + Intronic
1199997794 X:153037378-153037400 CTGGACTGGCTGATGGTGAAGGG - Intergenic
1201538358 Y:15077437-15077459 TTAGACTTGTTGAGAGTGAATGG + Intergenic