ID: 1089971472

View in Genome Browser
Species Human (GRCh38)
Location 11:122696913-122696935
Sequence CTATTTTAACAGCTAGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089971472_1089971480 25 Left 1089971472 11:122696913-122696935 CCCTGTGCTAGCTGTTAAAATAG 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1089971480 11:122696961-122696983 CAAGTAAAGATCAGGCCACCAGG 0: 1
1: 0
2: 0
3: 14
4: 133
1089971472_1089971479 17 Left 1089971472 11:122696913-122696935 CCCTGTGCTAGCTGTTAAAATAG 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1089971479 11:122696953-122696975 TTGTTTTTCAAGTAAAGATCAGG 0: 1
1: 0
2: 4
3: 162
4: 5364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089971472 Original CRISPR CTATTTTAACAGCTAGCACA GGG (reversed) Intronic
902755088 1:18543820-18543842 GTATTAAAACAGCTGGCACATGG + Intergenic
904973680 1:34439150-34439172 ATGTTTTAACAGCCAACACATGG + Intergenic
907921813 1:58921073-58921095 CTATTTTCACAGCTAGTAAATGG - Intergenic
913175592 1:116270236-116270258 TTATTTTAACAGCTAGATCTAGG - Intergenic
913656092 1:120961473-120961495 TTATTTTAAAGGCTAGCATATGG - Intergenic
914520651 1:148412705-148412727 TTATTTTAAAAGCTAACATATGG - Intergenic
917433249 1:174993284-174993306 CTAATTTAACAGCTGGGAGAGGG - Intronic
921124030 1:212161161-212161183 CTATTGTTACAGCTAGAACTAGG - Intergenic
922871662 1:228907032-228907054 CTATGTAAATAGCTAGCATATGG - Intergenic
923055069 1:230420177-230420199 CTAATTTAACAGCAAACAAAGGG + Intronic
923729568 1:236537321-236537343 CTATTCAAACAGCTAGAAAAAGG - Intronic
923982367 1:239339557-239339579 CTATTTCAACAAATAGCACATGG + Intergenic
924861127 1:247923605-247923627 CTATTTTCTCAGCTGGTACATGG + Intergenic
1063778369 10:9291145-9291167 CTATTTTAAAAGTTAGTTCAAGG + Intergenic
1064536047 10:16358892-16358914 ATATTTTAAAAGCCAGCAGAGGG - Intergenic
1065662502 10:28020329-28020351 CTATTTTAACAAATAGCACCTGG + Intergenic
1065718457 10:28599491-28599513 ATATTTTAACACATAGAACATGG - Intronic
1066799138 10:39164849-39164871 CTCTTTCAAAAGCTAGCAGAAGG + Intergenic
1070461837 10:76678084-76678106 CTTTTTTATCAAGTAGCACAAGG - Intergenic
1070710999 10:78683165-78683187 CTCTTTTAAAAGAAAGCACAGGG - Intergenic
1070868234 10:79723545-79723567 CTCTTTTAACAACTAGCTCTTGG + Intergenic
1071635146 10:87245746-87245768 CTCTTTTAACAACTAGCTCTTGG + Intergenic
1071660099 10:87492246-87492268 CTCTTTTAACAACTAGCTCTTGG - Intergenic
1071838854 10:89447717-89447739 CAAATTTAAAAGCTAGCAGAAGG + Intronic
1072639782 10:97203129-97203151 TTATTTTAAAAGTTTGCACATGG + Intronic
1075239297 10:120763665-120763687 CTATTTTCACAGCTAACCCTAGG - Intergenic
1078416282 11:11168830-11168852 ATATTTCAGCAGCTGGCACACGG - Intergenic
1080916760 11:36667726-36667748 CTTTTTTACCAGTTTGCACAGGG - Intergenic
1087027332 11:93662119-93662141 CTCTTTTAACAGCTACCAGGTGG - Intronic
1087223338 11:95569970-95569992 TCATTTTCACTGCTAGCACAGGG + Intergenic
1087389265 11:97513618-97513640 CTATTTTAGCTGATAGCACATGG - Intergenic
1087686804 11:101274309-101274331 GTATTTTAACAACTAGCTCAGGG - Intergenic
1089641793 11:119852714-119852736 CTGATTAAACAGCTAGCCCAAGG - Intergenic
1089793284 11:120959873-120959895 CAAATTTATCAGCTGGCACAGGG + Intronic
1089971472 11:122696913-122696935 CTATTTTAACAGCTAGCACAGGG - Intronic
1091888893 12:4037076-4037098 ATATTTGAAGAGCTATCACATGG - Intergenic
1091959054 12:4675276-4675298 CAAATTTAAAAGCTAGCAGAAGG + Intronic
1092159749 12:6310000-6310022 CTATTTTAGCAGCCACCGCAAGG + Intergenic
1092854620 12:12661498-12661520 TTGTTTTCACAGCTATCACATGG - Exonic
1093178999 12:15946757-15946779 CACATTTAACAGCTAGCAGAAGG - Intronic
1095217907 12:39571287-39571309 CTATTTTTACAGCCAACATATGG + Intronic
1095711743 12:45296106-45296128 TTATTTTAAAAGCAACCACACGG - Intronic
1097814815 12:64060806-64060828 CTATTTTAACAGCAAACCAACGG + Intronic
1100291841 12:93222928-93222950 TTATTTTAACAGATATGACATGG + Intergenic
1100333109 12:93604054-93604076 CTATTTTGACAGCTCTCAGAGGG + Intergenic
1106747914 13:32723004-32723026 GTATGTAAACAGCCAGCACAGGG + Intronic
1107416180 13:40202848-40202870 TTATTTTAACATCTAGCATAGGG + Intergenic
1108030192 13:46221116-46221138 CTATGTGTACAGCTGGCACATGG + Intronic
1108980946 13:56513013-56513035 AAATTTTAACAGCTTCCACAAGG + Intergenic
1111267737 13:85840510-85840532 CTCTCTTGACAACTAGCACAAGG - Intergenic
1115007810 14:28508158-28508180 CAAATTTAAAAGCTAGCAGAAGG - Intergenic
1115843938 14:37504715-37504737 CAAATTCAAAAGCTAGCACAAGG + Intronic
1116361171 14:44000048-44000070 ATATTTTAATAGCTATTACAAGG - Intergenic
1118287904 14:64493751-64493773 TTATATCAACACCTAGCACATGG - Intronic
1119315247 14:73688826-73688848 CTACTTTAAATGCTAGCATAAGG - Intronic
1123864195 15:24500771-24500793 CTATGTTTACAGCTGCCACAAGG - Intergenic
1124716558 15:32068338-32068360 CTACTTTATCAGATTGCACATGG + Intronic
1126899063 15:53293064-53293086 CTCCTTTAACACCTGGCACAGGG + Intergenic
1127347718 15:58117269-58117291 CTATTTTATCAAATAGCCCAGGG - Intronic
1128255242 15:66191408-66191430 TTATCTTAACAGCTGGCACCAGG + Intronic
1128432857 15:67615447-67615469 CTGTTTTAACAGCTAGAGCCTGG + Intronic
1130069579 15:80635235-80635257 CCATATCAACAGCTAGCCCAAGG - Intergenic
1134312635 16:13089833-13089855 CAAATTTAAAAGCTAGCAGAAGG - Intronic
1135646498 16:24167046-24167068 TTATTTTTAAAGCTAGCAGATGG - Intronic
1136031668 16:27507598-27507620 CCATTTTAACGTCTAGAACAGGG + Intronic
1146604108 17:34243556-34243578 CTATCTTAGCACCTAGGACAGGG - Intergenic
1148144925 17:45357539-45357561 CTAGTTTCACAGCTAGCAGTGGG + Intergenic
1149147577 17:53514980-53515002 CTATTTAAAAAGCCAACACATGG + Intergenic
1149345872 17:55734901-55734923 CTGTTTTTACAAGTAGCACAAGG + Intergenic
1150639741 17:66941564-66941586 AAACTTTAAGAGCTAGCACACGG + Intergenic
1156199916 18:34818975-34818997 CCATTTGAACAGTGAGCACATGG - Intronic
1157025569 18:43838583-43838605 CAATTTCAAAAGCTAGCAGAAGG + Intergenic
1163189074 19:15662955-15662977 ATATTTTAAAAGGTGGCACAAGG - Intergenic
1164185695 19:22866200-22866222 TTATTCTAAGAGCTAGAACAAGG - Intergenic
928112636 2:28522898-28522920 GTATTTTAAAAGCTAGACCAGGG + Intronic
929191285 2:39142485-39142507 TTATATTAACAGCTAAAACAAGG + Intergenic
929881948 2:45844537-45844559 CTATGTTAAAAGCAAGGACAAGG - Intronic
930226273 2:48797288-48797310 CTATTTTATAAGCTATCACAGGG + Intergenic
931207231 2:60159723-60159745 CTATTTCCACAGCTTGCTCAGGG + Intergenic
931885479 2:66612664-66612686 CAAATTTAAAAGCTAGCAGAAGG - Intergenic
932052105 2:68408311-68408333 CAAATTTAAAAGCTAGCAGAAGG + Intergenic
932925300 2:75966302-75966324 CTATTCTAAAAGAAAGCACATGG - Intergenic
933412904 2:81948221-81948243 CAAATTTAAAAGCTAGCAGAAGG - Intergenic
936610746 2:113999847-113999869 CCATTTTAAGAGCCAGGACATGG + Intergenic
937502627 2:122497464-122497486 TTATTTTATGAGCTAGCACATGG + Intergenic
939558185 2:143702161-143702183 ATACTTTAACTTCTAGCACAGGG - Intronic
939583234 2:143976504-143976526 TAATTCTAACAGCTAGGACAGGG - Intronic
939670660 2:145007620-145007642 TAATTTTGCCAGCTAGCACAAGG - Intergenic
939683245 2:145165101-145165123 ATAGTTTAACAGCCAGTACAAGG + Intergenic
940617844 2:156073070-156073092 CTATTACAATAGCTAGTACATGG + Intergenic
941661939 2:168204094-168204116 CTACTTTGCCAGCTAGCACCTGG - Intronic
941995307 2:171596433-171596455 CTCTTATAACAGCTAACACAGGG - Intergenic
942262214 2:174179394-174179416 ATATTTAAATATCTAGCACATGG - Intronic
948950588 2:241248683-241248705 CTGTTTTAACAGGTACTACAGGG + Intronic
1173701905 20:45079602-45079624 CTCTTTTACCAGCTTGCACTCGG + Exonic
1177865753 21:26511570-26511592 CCATTTTAAAAGCCAGCACTTGG - Intronic
1178344461 21:31812947-31812969 TTATTATACCAGCTGGCACATGG - Intergenic
949246590 3:1931809-1931831 CTAATTCAAAAGCTAGCAGAAGG + Intergenic
949782332 3:7703732-7703754 ATATTATAACAACTAGCTCAAGG - Intronic
951110653 3:18799792-18799814 ATATTTTAGCAGCTAGTTCATGG + Intergenic
953351846 3:42221807-42221829 CTCTTTTAACAGCTGCTACAGGG - Intronic
953653430 3:44827165-44827187 GGATTTTAACTTCTAGCACAGGG + Intronic
955469523 3:59272153-59272175 CAATTCCAACAGCTAGCACCAGG + Intergenic
959010594 3:101071044-101071066 TTATTTTAAAATCTAGCTCAGGG + Intergenic
960883549 3:122371000-122371022 CTATTTTAAGCTCTACCACAAGG - Intronic
961114268 3:124315291-124315313 CTATTCAAACAGGAAGCACAGGG + Intronic
962643429 3:137412411-137412433 TTCTTATAATAGCTAGCACAAGG - Intergenic
965329196 3:167349141-167349163 CTCCTACAACAGCTAGCACAGGG + Intronic
966955469 3:184873311-184873333 TTATTTTAAGAGCAAGCACAGGG + Intronic
967292340 3:187933481-187933503 CTATTTGAAGAGCAAGGACATGG - Intergenic
967907222 3:194511552-194511574 CTATTTTAAATGATAGCACCAGG - Intergenic
968039311 3:195575160-195575182 CTATTTTCAAAGCCAGCAAAAGG + Intronic
972951507 4:44329749-44329771 TTAATTTTACACCTAGCACAGGG - Intronic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
975219188 4:71794689-71794711 CAAATTTAAAAGCTAGCAGAAGG - Intronic
975988142 4:80225629-80225651 CTATTTCAACTTCTAGAACATGG - Intergenic
977352960 4:95911319-95911341 ATATTTTAACAGGTATCTCAGGG - Intergenic
978119226 4:105058480-105058502 GTATATTAAAAGCTAACACAAGG + Intergenic
980196096 4:129590832-129590854 CTCATTTAAAAGCTAGCAGAAGG + Intergenic
980449108 4:132947376-132947398 CTAGTTCAAAAGCTAGCAGAAGG + Intergenic
983017811 4:162637055-162637077 CCATTATAACAGCTAAAACAGGG - Intergenic
984509188 4:180658029-180658051 ATGTTTTAAAAGCTGGCACAAGG - Intergenic
988319426 5:29673354-29673376 CTATTTTAAAAACTGGCAAAGGG - Intergenic
990334262 5:54756720-54756742 CTATATTAAAAGCTAGAAGAAGG + Intergenic
993043829 5:82845083-82845105 CAAATTTAAAAGCTAGCAGAAGG - Intergenic
993379849 5:87194018-87194040 CTGTTTAAGCAGCAAGCACAGGG - Intergenic
994505824 5:100641843-100641865 ATATTTTACCAGTTTGCACAGGG - Intergenic
995153740 5:108884615-108884637 ATATTTTAAAAGTGAGCACAAGG - Intronic
995932790 5:117469673-117469695 CTATTTTCTGAGCTATCACAAGG + Intergenic
996442413 5:123507037-123507059 CTATTTAAAAAGCTTGCATAAGG + Intergenic
996682891 5:126247507-126247529 CTAATTCAAAAGCTAGCAGAAGG - Intergenic
997050732 5:130376900-130376922 CTATGTTTTCATCTAGCACAAGG - Intergenic
998599826 5:143574250-143574272 TTATTTTTACAGCTAACACTTGG - Intergenic
998615984 5:143741068-143741090 CTATTTTAAGAGCTAGAAATTGG - Intergenic
1001872288 5:175167336-175167358 CTATCTTAACATCTAGCATCAGG + Intergenic
1003593883 6:7457609-7457631 CTATATTAACAGCTGTAACACGG + Intergenic
1003971288 6:11301975-11301997 CAAATTCAACAGCTAGCAGAAGG + Intronic
1004064664 6:12231600-12231622 CTATTTCAAAAGCAAACACATGG + Intergenic
1005143300 6:22658948-22658970 CTATTTTAACAACTCTCACTAGG - Intergenic
1007994236 6:46289114-46289136 CTAGTTTAACAGGGAGCACAGGG + Intronic
1009605595 6:65863293-65863315 CAAATTCAAAAGCTAGCACAAGG - Intergenic
1009628926 6:66169579-66169601 CAAATTCAAAAGCTAGCACAAGG + Intergenic
1011091389 6:83605438-83605460 TTATTTTAACAGTTGGAACAAGG - Intronic
1011990949 6:93516625-93516647 CACTTTCAACAGCTAGCACCTGG + Intergenic
1012966370 6:105678319-105678341 CTATTTTGAGAGATAGAACAAGG - Intergenic
1013300057 6:108796443-108796465 CTTTTTTAACAACCTGCACATGG + Intergenic
1014839598 6:126202640-126202662 CAATGTTAACAGCTAGACCAAGG + Intergenic
1020488247 7:8745899-8745921 GTACTTTAACAGCTAGTGCATGG - Intronic
1020930436 7:14386546-14386568 CTATTTCAGCAACTGGCACATGG - Intronic
1022172912 7:27846656-27846678 CTCTTTTAAGTGCTAGCTCATGG + Intronic
1023749667 7:43360089-43360111 CTATTTTAACAGGGGGTACAGGG + Intronic
1024373517 7:48612598-48612620 TCATTTTAATAGCTAACACATGG + Intronic
1027777925 7:82489780-82489802 CAAATTTAAAAGCTAGCAGAAGG - Intergenic
1027881242 7:83840365-83840387 TTATTTAACCAGCTATCACAGGG + Intergenic
1030451857 7:109722217-109722239 CACATTTAAAAGCTAGCACAAGG + Intergenic
1031283862 7:119840750-119840772 CTATTTAAATAGAAAGCACAGGG + Intergenic
1034512177 7:151544967-151544989 CTATTTTATCAGTTAGGACCGGG + Intergenic
1037103722 8:15079760-15079782 CTATTTAATCAGCCTGCACATGG - Intronic
1039175291 8:34797322-34797344 ATCTTTCAACAGCTAGTACAAGG - Intergenic
1039453103 8:37691486-37691508 CTATTATTACACCTATCACATGG - Intergenic
1041121705 8:54592629-54592651 CTATTTTGGCAGCTGGCACCAGG + Intergenic
1041931507 8:63292276-63292298 CTATTTTAACATCTGCCAGAAGG - Intergenic
1044893330 8:96860879-96860901 CTATTTTCAAAACTAGTACATGG + Intronic
1045606035 8:103777691-103777713 ATATTTTAACAGCTTTCAAATGG - Intronic
1046380161 8:113439151-113439173 CTATTTGAACACATAACACATGG + Intergenic
1046608189 8:116393840-116393862 CAAATTTAAAAGCTAGCAGAAGG + Intergenic
1048015588 8:130493697-130493719 TTATTTTCACAGCTGGCACGGGG - Intergenic
1048063646 8:130946435-130946457 AGATTTTAACAGGTAGCAAAAGG - Intronic
1048083442 8:131153142-131153164 CTATTTTTACAACTGCCACATGG - Intergenic
1051460927 9:17314181-17314203 CTATTTTAACTACTATAACAAGG - Intronic
1051554505 9:18367468-18367490 CCAGTTTCACAGCTAGCAAATGG - Intergenic
1052320574 9:27163270-27163292 CTGTTTTGAAAGGTAGCACAGGG - Intronic
1052547484 9:29898880-29898902 ATATCTTAACTGCTAGCACTAGG + Intergenic
1056170056 9:83976553-83976575 GTTCTTTAACAGCTTGCACATGG - Intronic
1057505932 9:95633581-95633603 CTATTTTAAAAACTTGTACACGG + Intergenic
1058012286 9:99991624-99991646 CTAATTCAAAAGCTAGCAGAAGG + Intronic
1058575456 9:106396213-106396235 CTAGCTTAATAGCTGGCACAGGG - Intergenic
1059519053 9:114922734-114922756 CTATTTTTACTGGGAGCACATGG + Intronic
1186406224 X:9305987-9306009 CTATTTTATCATCTATCCCACGG + Intergenic
1187421497 X:19138057-19138079 ATATTTTAACTACAAGCACAAGG + Intergenic
1188576506 X:31657183-31657205 CTATTTTTTCAGCTTGCACAAGG + Intronic
1192543786 X:71996307-71996329 CTATTTGAACAGCTGTGACATGG - Intergenic
1193063105 X:77227731-77227753 CTAATCTAAAAGCTAGCAGAAGG + Intergenic
1197910147 X:131473482-131473504 CAAATTTAAAAGCTAGCAGAAGG - Intergenic
1198168654 X:134082565-134082587 CAAATTTAAAAGCTAGCAGAAGG + Intergenic