ID: 1089975637

View in Genome Browser
Species Human (GRCh38)
Location 11:122729310-122729332
Sequence ATGCCACGCGGTTCTTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 34}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089975629_1089975637 29 Left 1089975629 11:122729258-122729280 CCCAGAAGATGAAGCCTTGTCAC 0: 1
1: 0
2: 0
3: 24
4: 728
Right 1089975637 11:122729310-122729332 ATGCCACGCGGTTCTTGTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 34
1089975632_1089975637 15 Left 1089975632 11:122729272-122729294 CCTTGTCACTTTTGGTCTTGTGG 0: 1
1: 0
2: 2
3: 17
4: 181
Right 1089975637 11:122729310-122729332 ATGCCACGCGGTTCTTGTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 34
1089975630_1089975637 28 Left 1089975630 11:122729259-122729281 CCAGAAGATGAAGCCTTGTCACT 0: 1
1: 0
2: 1
3: 10
4: 141
Right 1089975637 11:122729310-122729332 ATGCCACGCGGTTCTTGTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 34
1089975634_1089975637 -8 Left 1089975634 11:122729295-122729317 CCCAGTTCAGCTGAGATGCCACG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1089975637 11:122729310-122729332 ATGCCACGCGGTTCTTGTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 34
1089975635_1089975637 -9 Left 1089975635 11:122729296-122729318 CCAGTTCAGCTGAGATGCCACGC 0: 1
1: 0
2: 1
3: 6
4: 64
Right 1089975637 11:122729310-122729332 ATGCCACGCGGTTCTTGTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089975637 Original CRISPR ATGCCACGCGGTTCTTGTTG AGG Intronic
905456813 1:38094030-38094052 ATGCCACGAGGTTGTTGTGAAGG + Intergenic
907837183 1:58121164-58121186 ATGCCACAAGGTTCTTTTTCAGG + Intronic
917117829 1:171620409-171620431 ATGCAAAGCTGTTCTTTTTGGGG + Intergenic
1081962941 11:47151624-47151646 ATGCCCAGCGTTTCTGGTTGAGG + Intronic
1087543397 11:99550008-99550030 ATTCCACGCAGGTTTTGTTGAGG + Intronic
1089975637 11:122729310-122729332 ATGCCACGCGGTTCTTGTTGAGG + Intronic
1090398553 11:126434509-126434531 ATCCCACGTGGAGCTTGTTGAGG + Intronic
1099929424 12:89056896-89056918 ATGCCACCCTGTTGTTGTTCTGG + Intergenic
1108597797 13:51964446-51964468 ATGCCAGGCCACTCTTGTTGTGG - Intronic
1123210325 14:106753970-106753992 TTGCAAGGAGGTTCTTGTTGGGG + Intergenic
1128028098 15:64456323-64456345 AACCCACCCGATTCTTGTTGCGG + Intergenic
1141886389 16:86895256-86895278 ATGCCACCAGCTTCTTGTAGCGG - Intergenic
1144041434 17:11414413-11414435 ATGCCACTGGGTTCCTGTTGAGG + Intronic
1148793374 17:50185900-50185922 AGGCCACGCTGTTCTTGCAGTGG + Exonic
1151360409 17:73585261-73585283 ATGCCATGCGCTTCTCGTAGTGG + Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1159120037 18:64158284-64158306 ATGCCACGCAGTGCCTGTGGGGG - Intergenic
1163464024 19:17455718-17455740 TTTCCACGCGGTACTTGTGGCGG + Exonic
1165147707 19:33742184-33742206 ATGCCATGGGGTTCTTCTTGGGG + Intronic
930235453 2:48884742-48884764 CTGCCACACTGTTCTTGGTGGGG - Intergenic
930246468 2:48988568-48988590 ATGCCAAGCAGTTCCTGTTCAGG - Intronic
940279789 2:151977311-151977333 ATGCCACGTGATTCATGATGGGG + Intronic
1182987589 22:34735192-34735214 ATGGCACGCAGTTATTCTTGGGG - Intergenic
954334660 3:49909255-49909277 AGGCCAGGAGGTTCTCGTTGGGG + Exonic
969095203 4:4727667-4727689 ATGCCAAGGGGTTCTTTCTGGGG - Intergenic
970132603 4:12887748-12887770 ATGCCACCAGGTTCTGGTTTGGG + Intergenic
983872526 4:172838410-172838432 CTGCCACACTGTTCTTGTGGGGG + Intronic
985519649 5:367565-367587 ATGCCACGTGGGCCTTGCTGGGG + Intronic
989983393 5:50667848-50667870 ATGGCACCCGGCACTTGTTGCGG + Intronic
997093482 5:130884327-130884349 ATGGCATGTGGTTCTAGTTGAGG - Intergenic
1005005967 6:21287933-21287955 AAGCCACCCGGTTTGTGTTGTGG - Intergenic
1015547574 6:134377038-134377060 ATGCCACTTGCTTCCTGTTGGGG + Intergenic
1018257678 6:161938822-161938844 ATGCAAAGTGGTTTTTGTTGAGG - Intronic
1018869058 6:167767711-167767733 ATGCCTCGGGTTTCTTCTTGAGG + Intergenic
1023282462 7:38585160-38585182 ATGCCATGGGGTTCTTGTGAGGG - Intronic
1026884636 7:73932751-73932773 CTGCCACGCAATTATTGTTGGGG + Intergenic
1062300155 9:135861943-135861965 CTGCCACACGCTTCGTGTTGGGG - Intronic
1186602268 X:11050352-11050374 ATGCCACGCAGTTGCTGCTGAGG + Intergenic
1187023964 X:15413411-15413433 ATGCCATGAGGTTCTTGATGAGG - Intronic