ID: 1089975637

View in Genome Browser
Species Human (GRCh38)
Location 11:122729310-122729332
Sequence ATGCCACGCGGTTCTTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 34}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089975630_1089975637 28 Left 1089975630 11:122729259-122729281 CCAGAAGATGAAGCCTTGTCACT 0: 1
1: 0
2: 1
3: 10
4: 141
Right 1089975637 11:122729310-122729332 ATGCCACGCGGTTCTTGTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 34
1089975635_1089975637 -9 Left 1089975635 11:122729296-122729318 CCAGTTCAGCTGAGATGCCACGC 0: 1
1: 0
2: 1
3: 6
4: 64
Right 1089975637 11:122729310-122729332 ATGCCACGCGGTTCTTGTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 34
1089975634_1089975637 -8 Left 1089975634 11:122729295-122729317 CCCAGTTCAGCTGAGATGCCACG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1089975637 11:122729310-122729332 ATGCCACGCGGTTCTTGTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 34
1089975632_1089975637 15 Left 1089975632 11:122729272-122729294 CCTTGTCACTTTTGGTCTTGTGG 0: 1
1: 0
2: 2
3: 17
4: 181
Right 1089975637 11:122729310-122729332 ATGCCACGCGGTTCTTGTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 34
1089975629_1089975637 29 Left 1089975629 11:122729258-122729280 CCCAGAAGATGAAGCCTTGTCAC 0: 1
1: 0
2: 0
3: 24
4: 728
Right 1089975637 11:122729310-122729332 ATGCCACGCGGTTCTTGTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089975637 Original CRISPR ATGCCACGCGGTTCTTGTTG AGG Intronic