ID: 1089977444

View in Genome Browser
Species Human (GRCh38)
Location 11:122744897-122744919
Sequence GTGCGCGCGCGCGCGCACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 7, 3: 38, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089977444 Original CRISPR GTGCGCGCGCGCGCGCACTT GGG Intronic
901660147 1:10794197-10794219 GTGCGCGCGCGCGCGCGTCGTGG + Intronic
906961383 1:50421313-50421335 TTGCGACAGCGCGCGCACTTGGG + Exonic
907526476 1:55056863-55056885 GTGCGTGCGCGCGCGCGCGTTGG + Intronic
910533951 1:88275030-88275052 GCGCGCGCGCGCGCGCGCCTGGG + Intergenic
912672256 1:111641645-111641667 GTGTGCGCGCGCATGCACATAGG + Intronic
912684243 1:111749444-111749466 GTGCGCGCGCGCGCGTGCTAGGG + Intronic
913319408 1:117577907-117577929 GTGTGCGCGCGCGCGCAATGAGG + Intergenic
915818781 1:158999084-158999106 GTGTGCGCGCGCACGCACGCAGG - Intergenic
917565382 1:176207269-176207291 GTGCGCGCGCGCGCGAGCGGCGG + Exonic
919930009 1:202215015-202215037 GTGTGTGCGCGCGCGCGCGTTGG + Intronic
920600601 1:207320872-207320894 GCGCGCGCGCGCGCGCGCCTCGG - Intergenic
1063624804 10:7679005-7679027 GTGCGCGCGCGCGCGGAGGGAGG - Intergenic
1069913597 10:71774032-71774054 GTGCGCGCGCGCATGCACTCAGG - Intronic
1071997569 10:91163012-91163034 GTGCGCGAGCGCGCGCGCGTGGG - Intronic
1073326219 10:102645196-102645218 GTGTGTGCGCGCGCGCGCGTAGG - Intronic
1074046400 10:109843505-109843527 GTGTGTGTGCGCGTGCACTTAGG - Intergenic
1074810204 10:117096994-117097016 GTGCGCGCGCGTGCGCGCTTGGG - Intronic
1076116918 10:127907305-127907327 GTCCGCACGCGCGCTCACCTCGG - Exonic
1076906295 10:133363338-133363360 GTGTGCGCGCGCGCACACCTGGG - Intronic
1083741340 11:64713068-64713090 TTGCGCGCGGGCGCGCACAGCGG + Exonic
1087003831 11:93449027-93449049 GTGCGCGCGTGCGCGCTCCTCGG + Intergenic
1088820483 11:113452472-113452494 GCGCGCGCGCGCGCGCACATTGG + Intronic
1088820485 11:113452474-113452496 GCGCGCGCGCGCGCACATTGGGG + Intronic
1089977444 11:122744897-122744919 GTGCGCGCGCGCGCGCACTTGGG + Intronic
1090439177 11:126712283-126712305 GTGCGCGCGTGCATGCATTTTGG + Intronic
1091023854 11:132124621-132124643 GTGCGCGCGCACGCGCAGGGCGG + Intronic
1091718273 12:2795085-2795107 GTGCCGGCGCGAGCGCACTCTGG - Exonic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1092899371 12:13044373-13044395 GGGCGCGCGCACGCGCACCGGGG + Exonic
1093547839 12:20369205-20369227 GTGTGTGCGCGCGCGCGCGTGGG + Intergenic
1093547840 12:20369209-20369231 GTGCGCGCGCGCGCGTGGGTCGG + Intergenic
1095799390 12:46256594-46256616 GTGCGCGCGCGCGCGCAAACTGG - Intronic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096481107 12:51941569-51941591 GTGTGTGCGCGCGCGCGCGTGGG - Intergenic
1096863780 12:54549410-54549432 GTGTGCGTGCGCTCGCCCTTGGG + Exonic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1101354716 12:103966119-103966141 TGGCGCGCGCGCGCGCACGCAGG + Intronic
1102651966 12:114448538-114448560 GTGCGCGCGCGCCAGGGCTTAGG - Intergenic
1102677249 12:114667322-114667344 GTGTGCGCGCTCGCGCGATTAGG - Intergenic
1103758817 12:123233134-123233156 GGGCGCGCGCGCGCTCCCTCGGG - Exonic
1103856369 12:123973246-123973268 GAGCGCGCGCGCGCGCGGCTCGG + Exonic
1108408083 13:50124567-50124589 GAGAGCGCGCGCGCGGGCTTCGG - Intronic
1108530891 13:51326038-51326060 GTGTGTGCGCGCGCGCACGTGGG + Intergenic
1112509429 13:99997064-99997086 GTGTGCGCGCGCGCGCCCCTGGG + Intergenic
1117721910 14:58637226-58637248 GTGCGCGCGCGTGCGCGCTTTGG - Intronic
1119325275 14:73756296-73756318 GCGCGCGCGCGTGCGCGCTGAGG + Intronic
1119613510 14:76083255-76083277 GTGCTCCGGCGCGAGCACTTTGG - Exonic
1121120884 14:91375267-91375289 GTGTGTGCGCGCGCGCATGTGGG + Intronic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1126393924 15:48191624-48191646 GCGCGCGCGCACACGTACTTCGG + Exonic
1126766478 15:52016049-52016071 GCGCGCGCGCGCGCGCGCGATGG - Intronic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1130225318 15:82052938-82052960 GCGCGCGTGCGCGCGCAGTGAGG - Intergenic
1130554406 15:84912789-84912811 GTGTGCGCGCGCGCAAAATTTGG - Intronic
1130849322 15:87778448-87778470 GCGCGCGCGCGCGTGCACACAGG - Intergenic
1131694237 15:94857650-94857672 GTGTGTGTGCGCGCGCACATGGG + Intergenic
1138956860 16:61981682-61981704 GCGCGCGCGCGCGTGCGCTTGGG + Intronic
1139754653 16:69132618-69132640 CTGAGAGCGCGCGCGCACGTGGG + Exonic
1140225123 16:73070909-73070931 GCGCGCGCGCGCGCGCAAGACGG - Intergenic
1146601968 17:34225231-34225253 GTGCGCGCGTGCGCGCGTGTTGG - Intergenic
1148284060 17:46372681-46372703 GAGCCCGCGCGCGCGCCCTGTGG + Intergenic
1148306281 17:46590602-46590624 GAGCCCGCGCGCGCGCCCTGTGG + Intergenic
1154954285 18:21240558-21240580 GTGCGCGCGCGCGCGCGGGCGGG - Intergenic
1156000353 18:32378052-32378074 GTGTGTGCGCGCGGGCGCTTTGG + Intronic
1162361248 19:10221781-10221803 GCGCGCGCGCGTGTGCACATAGG - Intronic
1162584514 19:11550920-11550942 GTGTGCACGCGCGCGCGCATTGG - Intergenic
1163369810 19:16895878-16895900 GCGCGCGCGCGCGCGCATACGGG - Intronic
1167156814 19:47743609-47743631 GTGCGCGCGCTCACGCACCGGGG + Intergenic
925532254 2:4877115-4877137 GTGTGTGCGCGCGCGCGCCTGGG - Intergenic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
926020184 2:9487836-9487858 GCGCGCGCGCGCGCGCTGTGGGG + Intronic
926820053 2:16842052-16842074 GTGCGCGCGCGGACGCACACAGG - Intergenic
926923576 2:17963770-17963792 GTGCGCGCGCGCGCGCGTCCAGG + Intronic
927000871 2:18792940-18792962 GTGTGCACGCGCGCGCAGTGGGG - Intergenic
927235518 2:20870908-20870930 GTGTGTGCGCGCGCGCATTCAGG + Intergenic
928093590 2:28391122-28391144 GCGCACGCGCGCGCGTCCTTGGG + Intergenic
929313282 2:40450368-40450390 GTGCACGCGCGCGCGCTGGTGGG + Intronic
930158849 2:48132581-48132603 GTGCACGCGCGCGCACGCATAGG - Intergenic
931649374 2:64454398-64454420 GGGCGCGCGCGCGCGCGCCCGGG - Exonic
931867127 2:66425559-66425581 GCGCGCGCGCGCGCGCGTTCCGG - Intergenic
932231368 2:70086955-70086977 GTGCGCGCGGGCGGGCACGTGGG - Intergenic
933724435 2:85418650-85418672 ACGCGCGCGCGCGCGCCTTTTGG + Intergenic
935097220 2:99957193-99957215 GTGCGCGCGCGCGCATTTTTAGG + Intronic
938900482 2:135795030-135795052 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
944494908 2:200296897-200296919 GTGTGCGTGCGCGCGCATTCAGG - Intergenic
944675548 2:202032656-202032678 GGGCGCTCGCGCGCGCTCTCTGG - Intergenic
944683637 2:202098818-202098840 GTGCACGCGCGCGCGCGCGCAGG + Intronic
945033357 2:205684937-205684959 GTGTGCGCGCTCGCGCGCTGGGG - Intronic
945203696 2:207310047-207310069 GTGCGCGCGCGCGCGCACGCAGG - Intergenic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
1169758873 20:9069291-9069313 GTGCGCGCGCGCGCGCGTCCGGG - Intronic
1172489224 20:35321286-35321308 GCGCGCGCGCGCGCACGCTCAGG + Intronic
1173429589 20:42974458-42974480 GTGTGTGCGCGCGTGCACTGAGG - Intronic
1173649050 20:44651557-44651579 GCCCCCGCGCGCGCTCACTTTGG + Exonic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1174467865 20:50731430-50731452 GTGCGCGCGCGCGGGCTCGCGGG + Intergenic
1175417890 20:58813449-58813471 GTGTGTGCGCGCGCGCATGTGGG - Intergenic
1175429248 20:58890930-58890952 GGGAGCGCGCGCCCGGACTTAGG - Intronic
1175808069 20:61841765-61841787 GTGCGCGCGTGCGCGCACCGTGG + Intronic
1175841312 20:62029469-62029491 GTGTGCGCGCGCGCGCACGTGGG - Intronic
1177077013 21:16588646-16588668 GTGCGCGCGCGTGCTCGCTCGGG + Intergenic
1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG + Intergenic
1180620714 22:17159787-17159809 GTCCGCCCCCGCGCGCACTGCGG + Intronic
1181069257 22:20322341-20322363 GTGTGTGCGCGCGCGCACAATGG - Intergenic
1181413296 22:22740185-22740207 GCGCGTGCGCGCGCGCTCTTTGG - Intronic
1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG + Intronic
1182709619 22:32312346-32312368 GTGCGCGCGCGCGTGTGATTTGG - Intergenic
1183504738 22:38202715-38202737 GTCCGCGCGCGCGCTCCCTGGGG + Intronic
1183702386 22:39457683-39457705 GGGCGGGCGCGGGCGCACTGGGG + Intronic
951110000 3:18792006-18792028 GTGTGCGCGCGCACGCACACAGG - Intergenic
953549956 3:43894429-43894451 GGGCGTGCGCGCGTGCACGTGGG - Intergenic
953631993 3:44625733-44625755 GTGTGCGCGCGCGCGCGCAAAGG - Intronic
956179085 3:66500924-66500946 GCGCGCGCGCGCGCGCTCTCTGG - Exonic
958641784 3:96814560-96814582 TTGCGCGCGCGCGCTCTCTCCGG + Intronic
963722083 3:148873350-148873372 GTGCGCGCGTGCATGCACTGGGG - Intronic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
966593005 3:181702018-181702040 GTGTGCGCGCGCGCGCATGGGGG - Intergenic
966593007 3:181702020-181702042 GTGTGTGCGCGCGCGCGCATGGG - Intergenic
970826545 4:20283105-20283127 GTGTGTGCGCGCGCGCACACAGG - Intronic
972499494 4:39664219-39664241 GCGCGCGCGCGCGCGCATGACGG + Intergenic
975801147 4:78059486-78059508 GTGCGTGTGGGCGCGTACTTTGG + Intronic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
977908465 4:102502369-102502391 GCGCGCGCGCGCGCGCACGGAGG - Intronic
984167447 4:176319908-176319930 GGGCGCGCGCGCGCTCGCGTCGG + Intergenic
987303420 5:16617006-16617028 GCGCGCGCGCGGGCGCGCCTGGG + Exonic
987901086 5:24013048-24013070 GTGCGCGCGCGCGCAGGCTGTGG + Intronic
988341373 5:29976558-29976580 GTGCGCGCGCGCGCATTGTTTGG - Intergenic
990955212 5:61333036-61333058 GTGCGGGCGCGCGCGGAACTAGG - Intronic
993550711 5:89270424-89270446 GTGTGCGCGCGCGCGCATGCTGG - Intergenic
997237158 5:132279342-132279364 GTGCGCGCGCGCGCGCGCGTGGG - Intronic
998029503 5:138852852-138852874 GTGCGCGCGCGCGCGAAAAGAGG - Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
998963271 5:147510186-147510208 GTGTGCGCGCGCGCCAAGTTTGG - Intergenic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002559739 5:180072914-180072936 GTGTGCGCGCGCGCGCGTTTCGG - Intergenic
1004720445 6:18264216-18264238 GGGCGGGCGCGCGCGCACGCGGG - Intronic
1007702067 6:43771374-43771396 GTGCGTGCGAGCGCGCGCGTGGG + Intronic
1007800452 6:44387920-44387942 GTGCGCACGCGCGCGGAGGTCGG + Intronic
1012515945 6:100059382-100059404 GTGCGTGCGCGCACGCACTGAGG + Intergenic
1012872899 6:104693055-104693077 GTGCACGCGCGCGCGCGCTGGGG + Intergenic
1013576054 6:111483844-111483866 GGGCGCGCGGGCGCGGGCTTCGG + Intergenic
1015512473 6:134052230-134052252 GTATGCGCGCGCGCGCATGTGGG - Intronic
1016823701 6:148368747-148368769 GCGCGCGTGCGCGCGCATGTGGG - Intronic
1017163830 6:151390435-151390457 GCGAGCGCGCGCGCGCACGCGGG - Intronic
1020253000 7:6484184-6484206 GCGCGCGCGCGCCGGCAGTTCGG - Exonic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1021949840 7:25763970-25763992 GTGTGTGCGCGCGTGCATTTGGG + Intergenic
1022133305 7:27424004-27424026 GCGCGCGTGCGCGTGCACTTGGG - Intergenic
1023319419 7:38976616-38976638 GTGTGTGTGCGCGCGCGCTTCGG + Intergenic
1023447680 7:40248869-40248891 GTGCGAGCGCGCGCGCGCGCTGG - Intronic
1024760616 7:52592614-52592636 GTGCACGCGCACGTGCATTTGGG - Intergenic
1030394492 7:108968546-108968568 GTGCGCGCGCGCGCACTATTTGG + Intergenic
1031213281 7:118858667-118858689 GAGCGCGCGCGCGCGCGCGTGGG - Intergenic
1033300015 7:140177043-140177065 GGCCTCGCGCGCGCGCACTGAGG - Intergenic
1037878411 8:22560871-22560893 GTGCGCGCGCGCACGCGCCGTGG + Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1044115311 8:88327743-88327765 GCGCGCGCGCGCGCGCGCCAAGG - Intronic
1047423567 8:124727081-124727103 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
1049989361 9:977080-977102 TTGCGGCAGCGCGCGCACTTGGG - Exonic
1049998446 9:1051974-1051996 TTGCGGCAGCGCGCGCACTTGGG - Exonic
1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG + Intergenic
1054842663 9:69760020-69760042 GCGCGCGCGCGCGGGTGCTTCGG + Intergenic
1055158921 9:73100353-73100375 GCGCGCGCGCGCGCGTGCATAGG + Intergenic
1056341589 9:85639350-85639372 GTGTGCGCGTGCGCGCGCATGGG - Intronic
1057995914 9:99821683-99821705 GCGCGCGCGCGCGCGTTCCTCGG - Intergenic
1059269328 9:113062085-113062107 GTGTGCGCGCCCGCGTGCTTGGG + Intergenic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1185747350 X:2583817-2583839 GTGCGCTCGTGCGGGCGCTTTGG - Intergenic
1186209982 X:7240450-7240472 GTGTGTGCGCGCGCGCTCCTTGG - Intronic
1186490594 X:9969422-9969444 GTGTGTGCGCGCGTGCACTGGGG - Intergenic
1187265002 X:17723769-17723791 GTGCGCGCGCGTGCGCGCATGGG + Intronic
1188594242 X:31877693-31877715 GTGCACGCACGCGCGCACACAGG + Intronic
1188597812 X:31922522-31922544 GTGTGCGCGCGCGTGCGCTAGGG + Intronic
1190862635 X:54358648-54358670 GCCCCCGCGCGCGCGCACTGCGG - Intergenic
1198441506 X:136667841-136667863 GTGCGTGCACGTGCGCGCTTGGG - Exonic
1199760116 X:150898700-150898722 CCGCGCGCGCGCGCGGGCTTTGG - Exonic
1200473071 Y:3609841-3609863 GTGTGCGCGCGCGCGCTTCTAGG + Intergenic
1201575344 Y:15456289-15456311 GCGCACGCGCACGCGCACCTTGG + Intergenic