ID: 1089977874

View in Genome Browser
Species Human (GRCh38)
Location 11:122748070-122748092
Sequence CAAAAGGAGGATCCTGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089977874 Original CRISPR CAAAAGGAGGATCCTGCAAA AGG Intronic
903292246 1:22321657-22321679 CAAAAGCAGGAAACTCCAAAGGG - Intergenic
903889717 1:26561344-26561366 CAAAAGGAGGATGCTGACACTGG - Intronic
910905272 1:92170512-92170534 ACAAAGCAGGATCCTGAAAATGG - Intronic
912221058 1:107675990-107676012 CAAACAGAGGATCCTACAAATGG + Intronic
912860534 1:113210256-113210278 CAGAAACAGGAACCTGCAAAGGG + Intergenic
915085326 1:153384265-153384287 CCAAAGAAGGATCCTTCAGATGG + Intergenic
922037672 1:221865413-221865435 CAAAAGGAAGAGCCAGCAGATGG + Intergenic
923086761 1:230708335-230708357 GAGAAGGAGGGTCCTGCAGAAGG - Intronic
923252921 1:232193781-232193803 CCTAAAGATGATCCTGCAAAAGG - Intergenic
923474920 1:234323154-234323176 AAGAAGGAGGAGCCTGCAGAGGG + Exonic
1064141299 10:12792861-12792883 CAAAAGGATAAAACTGCAAAAGG - Intronic
1064310101 10:14204642-14204664 AAAAGAGAGGGTCCTGCAAAAGG - Intronic
1064341017 10:14485329-14485351 CAAAAGGAGGGGGCTACAAAAGG - Intergenic
1068012723 10:51474523-51474545 CAAAAAGTAGATCCTGCAATAGG - Intronic
1071561216 10:86648383-86648405 CAAAAGAAGCCTCCAGCAAAAGG + Intergenic
1072422567 10:95301444-95301466 CAAAAGGGGGATCTTGGTAAAGG + Intergenic
1073824830 10:107308519-107308541 GAACTGGAGGATCCTGCACATGG + Intergenic
1075834627 10:125443177-125443199 CAAAAGGAGGAGGTTGGAAAGGG - Intergenic
1077024881 11:434685-434707 CACAGGGAGGATCCTGCAGCAGG + Intronic
1077453424 11:2664261-2664283 AACAAGGAGGTTGCTGCAAAGGG + Intronic
1078060869 11:8042113-8042135 GAAAAGGGGGAGACTGCAAATGG - Intronic
1078295754 11:10068282-10068304 CAAAATGAGGATTCAGGAAAGGG - Intronic
1087438880 11:98158015-98158037 GAAAAGAAGAATCCTGGAAAAGG - Intergenic
1089977874 11:122748070-122748092 CAAAAGGAGGATCCTGCAAAAGG + Intronic
1091105968 11:132920306-132920328 CAAAAGGAGACTCATGCAAATGG + Intronic
1091174580 11:133546842-133546864 CTAAAGGAGGAGGCTGCACAGGG - Intergenic
1091477117 12:785698-785720 CAAAAAAAGGAACCTGGAAAAGG - Intronic
1092479240 12:8845265-8845287 CAAATGCAGGATGCTGCCAACGG - Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1097986437 12:65787437-65787459 CAAAAGCAGGATTGCGCAAAGGG + Intergenic
1098698165 12:73585887-73585909 CAAATAGAGGATTCTGCAAGTGG + Intergenic
1099840595 12:87960546-87960568 CAAAATGAGGACCCTTAAAAAGG + Intergenic
1101433920 12:104649012-104649034 CAACAGGAGGAACCAGCAAGAGG - Intronic
1102193831 12:111009732-111009754 CATAACGGGGATCCTGCAAGTGG - Intergenic
1107097004 13:36548008-36548030 CTTAAGGAGGATCCAGCAGATGG - Intergenic
1110539730 13:76694697-76694719 CAGAAGGAGGATCCAGAGAAAGG + Intergenic
1111473629 13:88718479-88718501 CAAGAGGAGGAACATGCAGAGGG - Intergenic
1112429970 13:99342722-99342744 AACAAGGAGGATCCAGCTAAAGG - Intronic
1113115742 13:106873178-106873200 CAACAGGAGGAGGATGCAAAGGG - Intergenic
1114064197 14:19046676-19046698 GAAAAAGAGGGCCCTGCAAAAGG - Intergenic
1114098062 14:19353322-19353344 GAAAAAGAGGGCCCTGCAAAAGG + Intergenic
1117575516 14:57093271-57093293 CACAAGGAGGATCCAGCAAAGGG + Intergenic
1118650109 14:67882342-67882364 GATGAGGAGGATCCAGCAAAAGG - Intronic
1119416763 14:74476146-74476168 ACAAAGGGGGATACTGCAAATGG - Intergenic
1124853533 15:33364418-33364440 GAACAGAAGGACCCTGCAAAGGG - Intronic
1126512912 15:49500904-49500926 CAAAAGCAGGATCAAGCAAGAGG - Intronic
1131298291 15:91171913-91171935 CAGAAGGATGATTCTGCAGATGG - Intronic
1131892969 15:96993819-96993841 CAAAAGAAGGATTTTGCAAATGG + Intergenic
1132264159 15:100451779-100451801 TAAAAAGATAATCCTGCAAATGG + Intronic
1132614179 16:832157-832179 CAAATGGATGAACCTGCCAATGG + Intergenic
1133823177 16:9254858-9254880 CAAAATATGGAACCTGCAAAAGG - Intergenic
1134326553 16:13213000-13213022 CAAAAGAAGCCTCCTGAAAAAGG - Intronic
1136187448 16:28596555-28596577 CAAAAGGAGGATCCTGGGCAGGG + Intronic
1138071327 16:53995834-53995856 GAAAATGAGCATCCAGCAAAGGG - Intronic
1139672900 16:68503822-68503844 CAGAAGGAGGATACTGGTAACGG + Intergenic
1140712928 16:77695099-77695121 GAAAAGGAGGAGTCAGCAAATGG - Intergenic
1143910419 17:10244405-10244427 TGAAAGGAGGATCCTGCAGGAGG + Intergenic
1148208894 17:45796356-45796378 CAACAGTAGGACCCTGCCAATGG - Intronic
1148786972 17:50150321-50150343 CAAAAGTATGTTCCTGCAGATGG - Exonic
1151279124 17:73058771-73058793 CAAAAGACAGATCCTACAAAAGG - Intronic
1151643617 17:75414580-75414602 CCAAAGGAGTAGCCTGCACAAGG - Intergenic
1154105356 18:11518131-11518153 TAAAATGAGAATCCAGCAAAAGG + Intergenic
1156466895 18:37353473-37353495 CAATTGGAACATCCTGCAAAGGG + Intronic
1156532875 18:37835125-37835147 AAAAAGGAGGACAGTGCAAATGG + Intergenic
1158025191 18:52887432-52887454 CAAAAGGTAGTTCCAGCAAAAGG + Intronic
1158070386 18:53463056-53463078 AATATGGAGGTTCCTGCAAAAGG - Intronic
1158102979 18:53851731-53851753 CAAAAGGAAGATCTTTGAAAGGG - Intergenic
1158973873 18:62692890-62692912 CAAAAAGAGGAGGCTGCAAATGG - Intergenic
1159519339 18:69497421-69497443 CACAAGCAGGATCCTTGAAAAGG + Intronic
1161007747 19:1944879-1944901 CTACAGGAGGACCCGGCAAAGGG - Intronic
1161975533 19:7606177-7606199 GAAAAGGAAGAACCTGCAGATGG - Intronic
1163406448 19:17126038-17126060 CACAAGGAAGACCCTGCGAAGGG - Intronic
1165258627 19:34595276-34595298 CAAAATGTGGAGGCTGCAAAAGG + Exonic
1166911974 19:46165361-46165383 CAAAGGGAGGATGTTACAAAGGG + Intergenic
1167782264 19:51606480-51606502 AAATAGGAGGATCATGGAAATGG + Intergenic
1167883725 19:52483503-52483525 CAATAGGATGTTCCTGCAGATGG - Intronic
1167887006 19:52508463-52508485 CAATAGGATGTTCCTGCAGATGG - Intronic
1167889986 19:52531572-52531594 CAATAGGATGTTCCTGCAGATGG - Intronic
1167914599 19:52730488-52730510 CAATAGGATGTTCCTGCAGATGG + Intronic
1167989778 19:53348545-53348567 CAATAGGATGTTCCTGCAGATGG - Intronic
1167993272 19:53378809-53378831 CAATAGGATGTTCCTGCAGATGG - Intronic
930174519 2:48288207-48288229 GAAAATGAGGAAGCTGCAAAAGG + Intergenic
931427208 2:62182177-62182199 CAGAGGGAGAATCCAGCAAAAGG - Intergenic
932024131 2:68116552-68116574 CTGAAGGAGGATCCTGGGAAGGG - Intergenic
933759122 2:85662141-85662163 CGACAGGAGAGTCCTGCAAAGGG - Intronic
937564056 2:123262096-123262118 CAAAAGGAGAATCATTCTAATGG + Intergenic
938481461 2:131665683-131665705 GAAAAAGAGGGCCCTGCAAAAGG - Intergenic
938804056 2:134789571-134789593 CAGGAGGATGATCCTGCAAGGGG + Intergenic
939043198 2:137217025-137217047 CAAAAGGAAAATTTTGCAAAAGG - Intronic
939355915 2:141101696-141101718 TAAAATGAAGATCCTGAAAAAGG - Intronic
941066315 2:160907078-160907100 CAAAGGGAGGAACATGGAAAGGG + Intergenic
941377975 2:164754294-164754316 CAAAGGGAGGAGACTGCACAAGG - Intronic
944821430 2:203436168-203436190 CCAAAGGCATATCCTGCAAAGGG - Exonic
948329204 2:237151659-237151681 AAAAAGGAGGAGCCAGCGAAGGG - Intergenic
948497776 2:238364598-238364620 CAAAGGGAAGATCATGTAAAAGG - Intronic
1171029354 20:21663376-21663398 CAGAAGGAGGAGCCTGGAGAAGG + Intergenic
1171116943 20:22533116-22533138 CAAAAGGAGGATACTACCCACGG + Intergenic
1173161064 20:40652981-40653003 CAAGAGGAGGTTCCTTGAAAGGG + Intergenic
1173433159 20:43009471-43009493 AAAAAGGAGGTTCCAGGAAAGGG + Intronic
1176446225 21:6823300-6823322 GAAAAAGAGGGCCCTGCAAAAGG - Intergenic
1176824393 21:13688330-13688352 GAAAAAGAGGGCCCTGCAAAAGG - Intergenic
1177006999 21:15685944-15685966 GAGAAGGAAGCTCCTGCAAATGG + Intergenic
1178874930 21:36406797-36406819 CAAGAGATGGATCTTGCAAAGGG + Intronic
1180482690 22:15769309-15769331 GAAAAAGAGGGCCCTGCAAAAGG - Intergenic
1180756502 22:18165596-18165618 CAAAAGGAAGAATCTGTAAATGG + Intronic
1181075267 22:20371838-20371860 CAAAAGGAAGAATCTGTAAATGG - Intronic
1184499483 22:44863199-44863221 CAGAGGGAGGGCCCTGCAAAGGG + Intergenic
1184548315 22:45189154-45189176 CAAAATGTGGAGGCTGCAAAAGG - Intergenic
949195712 3:1304231-1304253 CAAAAGTATGATCCTGAAAGAGG - Intronic
949935002 3:9109801-9109823 CACAGGGAGGAGCCTTCAAAGGG + Intronic
949992920 3:9593815-9593837 CTAAAGATGGATCCTCCAAAAGG - Intergenic
950082926 3:10236152-10236174 CAGAAGGAACACCCTGCAAATGG + Intronic
950935833 3:16837916-16837938 TAAAAGCAGGGCCCTGCAAAAGG + Intronic
952402622 3:32976834-32976856 CAAAAGGATGATCAAGAAAATGG + Intergenic
952627132 3:35419255-35419277 CAATAGGAGATTCCTGGAAAAGG - Intergenic
953501262 3:43436981-43437003 CAAAAGGAGTGCCCTGAAAAAGG + Intronic
953746358 3:45576985-45577007 CAAAAATAGGATCCTGGGAAGGG + Intronic
955545169 3:60020121-60020143 ACAAAGGGGGATGCTGCAAAAGG + Intronic
956688093 3:71850732-71850754 CAAAATGAGGAGCCTGGGAAAGG - Intergenic
959635728 3:108566406-108566428 CCAAAGGATGGTCCTCCAAAAGG + Intronic
960521643 3:118662126-118662148 CAAAAGAAAGATCCTGTGAAAGG - Intergenic
960607253 3:119519411-119519433 GAAAAGGATGTTCATGCAAATGG + Intronic
960880652 3:122341390-122341412 CAAAAGGAGATTCATTCAAATGG - Intronic
961580841 3:127880773-127880795 CAAACAGAGGATGCTGGAAATGG + Intergenic
962549191 3:136471797-136471819 CAAAAGGAAGAACCCTCAAAGGG - Intronic
962944396 3:140154161-140154183 CAGATGGAGGATCCTTCAGATGG + Intronic
962977625 3:140459511-140459533 CCAGAGGAGGCTCCTGCAGAGGG - Exonic
963708319 3:148716279-148716301 AAAAAGGAGGCTCCTAGAAATGG + Intronic
966469671 3:180274990-180275012 GAAACAGAGGCTCCTGCAAATGG - Intergenic
970084565 4:12332349-12332371 CAAAAGGAGGCTCATAAAAATGG + Intergenic
971155169 4:24074081-24074103 GAAAGGGAGGATCCCGCAAAAGG + Intergenic
975639756 4:76488574-76488596 TAAATGGAGGATGCTGGAAATGG - Intronic
976334494 4:83869943-83869965 CAAGAGTAGGATGCTGCAGATGG - Intergenic
979230683 4:118346058-118346080 CAAAAGGACATTCCTGCAGAGGG + Intronic
980854516 4:138423550-138423572 CAAAGGGAGGTTCCTGAGAAAGG + Intergenic
981613930 4:146626356-146626378 TAAGAGGAGGATCCTTTAAAAGG + Intergenic
982997625 4:162369770-162369792 CAACAGGAGGATCATGAAAATGG + Intergenic
985036303 4:185843183-185843205 CAAAAGGAGGATGATTCAATGGG + Intronic
986007087 5:3677351-3677373 CAGGAGGAGGCTCCAGCAAAGGG - Intergenic
988613786 5:32753721-32753743 TTAAAGGAGGAACCTGGAAAAGG + Intronic
989159063 5:38372521-38372543 GAAAAGCAGGATCCAGCAATGGG - Intronic
991574847 5:68092226-68092248 CAAAAGCAGGAACGGGCAAACGG + Intergenic
995041438 5:107592678-107592700 GAAAAGGAGGATCCTGGAGCTGG + Intronic
997023085 5:130025321-130025343 CAAAAGAAGCAACATGCAAAAGG + Intronic
999858913 5:155624248-155624270 GAAAAGGAAGCACCTGCAAAGGG + Intergenic
1000965186 5:167647632-167647654 GAAAAGGAGGATGTTGCGAAGGG + Intronic
1001854495 5:174999292-174999314 CAAAAAGAGGCATCTGCAAAAGG - Intergenic
1004970597 6:20905661-20905683 AAAAAGGAGTATCTTGAAAACGG + Intronic
1005762248 6:28977864-28977886 AAAAAGGAAGATCGAGCAAAGGG - Intergenic
1006279909 6:33043231-33043253 GAAAAGGACTATACTGCAAAAGG - Intergenic
1007439576 6:41846668-41846690 CAAAAGGAGATTACAGCAAAAGG + Intronic
1008485349 6:52029370-52029392 CATAAGGAAGATGCTGCAAGGGG + Intronic
1012061624 6:94491417-94491439 CAAAGGGAAGACCCTGCAAGTGG + Intergenic
1012735114 6:102928937-102928959 CAAAAGGAGGATGCAGTAAGAGG - Intergenic
1013316371 6:108947081-108947103 CAGAGGGAGGAGCCTGGAAAGGG + Intronic
1014459915 6:121683860-121683882 AAACAGGAGGAGCCTGTAAATGG + Intergenic
1014982294 6:127959060-127959082 GAAAAGGACTATACTGCAAAAGG + Intergenic
1016574252 6:145550184-145550206 CTAAAGATGGATCCTACAAAAGG + Intronic
1017429310 6:154354943-154354965 CTTAAAGAGAATCCTGCAAATGG - Intronic
1019162363 6:170077047-170077069 CAAAGGGAGGACCCTGCACAAGG + Intergenic
1019456705 7:1131423-1131445 CAAAAGGCAGAGCCTGCACAAGG + Intronic
1022086802 7:27076483-27076505 TAAAAGGAGGGAACTGCAAAGGG + Intergenic
1023840468 7:44094361-44094383 AATAATGAGGCTCCTGCAAAGGG + Intergenic
1024331185 7:48156905-48156927 AAAACTGATGATCCTGCAAAGGG + Intergenic
1026541339 7:71282571-71282593 CAAAAGGAAAATCCTGCATAAGG + Intronic
1028074573 7:86496202-86496224 TAAAAGGAGGATACTGTGAATGG + Intergenic
1028253715 7:88566292-88566314 CAAAGGGAGGAAGCTGCACAGGG + Intergenic
1030335865 7:108325082-108325104 CAAAGGGAAGATTCTGGAAATGG + Intronic
1034009429 7:147512250-147512272 CAAAAGGACAAGTCTGCAAATGG - Intronic
1034905066 7:154936883-154936905 CAAAATGTGGAGGCTGCAAAAGG + Intronic
1035518371 8:255826-255848 CAAAGGGTGGGTCCTGCACAGGG + Intergenic
1037552275 8:19986087-19986109 CACAAGGAGGATTGTGCATAGGG + Intergenic
1048103832 8:131385178-131385200 CATAAGGAAGATCCAGCAAGCGG - Intergenic
1048852470 8:138658089-138658111 CAGAAGGAGGATCCTGGAACAGG + Intronic
1052832560 9:33228218-33228240 CAAAGGAAGGATCCTGAAATGGG - Intronic
1052839602 9:33280587-33280609 CAAAAGGGGGCTCCTCCACAGGG - Intronic
1054847137 9:69809429-69809451 CATTAGGAGGAAGCTGCAAAAGG - Intergenic
1056242203 9:84659048-84659070 GTAAAGGAGATTCCTGCAAATGG + Intergenic
1059158845 9:112014489-112014511 CACAAGTAGGATACTGAAAAAGG + Intergenic
1061386885 9:130295661-130295683 CACAGGGAGGATCCTGCAGGAGG + Intronic
1062369617 9:136231130-136231152 CAAACGCAGGATCCTACAGACGG + Intronic
1203522966 Un_GL000213v1:61230-61252 GAAAAAGAGGGCCCTGCAAAAGG + Intergenic
1186118019 X:6325586-6325608 CCAAAGGAGGATCCAGGAACAGG + Intergenic
1187866302 X:23726309-23726331 GAAAAAGAGGAACCTACAAAGGG + Intronic
1188199783 X:27283895-27283917 CAAAACAAGCATCATGCAAAAGG + Intergenic
1189442073 X:41046240-41046262 CAGAAGGAGCTCCCTGCAAAGGG - Intergenic
1190064604 X:47231336-47231358 GAAAAGGAGGGCCTTGCAAAGGG + Intergenic
1193979395 X:88162711-88162733 CTAAAGGAGCAGCATGCAAATGG - Intergenic
1194438961 X:93905890-93905912 CTGAAGGAGGTTCCTGAAAAAGG - Intergenic
1196271275 X:113714534-113714556 CAAAAGCATGATCCTTCAAAAGG - Intergenic
1197864449 X:131002890-131002912 CACAATGAGAATCCAGCAAAGGG + Intergenic
1201267017 Y:12216985-12217007 CAAAAAGTGCATCCTGCACAGGG - Intergenic