ID: 1089979707

View in Genome Browser
Species Human (GRCh38)
Location 11:122762192-122762214
Sequence CTGTTGTCCTTGGGTAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089979696_1089979707 30 Left 1089979696 11:122762139-122762161 CCGACCTAATAACATCTGTGACC 0: 1
1: 0
2: 1
3: 13
4: 102
Right 1089979707 11:122762192-122762214 CTGTTGTCCTTGGGTAAGACAGG 0: 1
1: 0
2: 1
3: 11
4: 113
1089979699_1089979707 9 Left 1089979699 11:122762160-122762182 CCTCATTCTGGAATCACCGTGCC 0: 1
1: 0
2: 1
3: 3
4: 85
Right 1089979707 11:122762192-122762214 CTGTTGTCCTTGGGTAAGACAGG 0: 1
1: 0
2: 1
3: 11
4: 113
1089979701_1089979707 -7 Left 1089979701 11:122762176-122762198 CCGTGCCCCTGGCTTGCTGTTGT 0: 1
1: 0
2: 8
3: 34
4: 390
Right 1089979707 11:122762192-122762214 CTGTTGTCCTTGGGTAAGACAGG 0: 1
1: 0
2: 1
3: 11
4: 113
1089979697_1089979707 26 Left 1089979697 11:122762143-122762165 CCTAATAACATCTGTGACCTCAT 0: 1
1: 0
2: 3
3: 19
4: 222
Right 1089979707 11:122762192-122762214 CTGTTGTCCTTGGGTAAGACAGG 0: 1
1: 0
2: 1
3: 11
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089979707 Original CRISPR CTGTTGTCCTTGGGTAAGAC AGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900833363 1:4980736-4980758 CAGTTTCCCTTGGGTAAGGCAGG + Intergenic
901050985 1:6425742-6425764 CTGATGTCCTGGGGTCAGCCTGG - Intronic
916556719 1:165899835-165899857 CTGTTGTCCTTGGCTCAGGGAGG + Intronic
917432979 1:174990004-174990026 CTCTTGTGCTTGGGTAAGGCTGG - Intronic
918251192 1:182704827-182704849 ATGTTGGCCCTGGGTAAGCCTGG - Intergenic
918313751 1:183305558-183305580 CTGTTTTTCCTGGGTAAAACAGG + Intronic
921228430 1:213044095-213044117 CTGTGGTACCTGGGTAATACTGG + Intergenic
922325126 1:224521231-224521253 ATGTTGTCCTTGGTTTAGACTGG + Intronic
922823561 1:228501661-228501683 CTGGTGGCCTTGGGTCACACTGG - Intergenic
1064340889 10:14484301-14484323 CTGTTTTAGTTGGGTATGACAGG - Intergenic
1067048429 10:42998913-42998935 CTGTTGTCCATGGCCAGGACTGG - Intergenic
1072388808 10:94960517-94960539 CTTCTGTCCTTGGCTAAGAAAGG + Intronic
1075587461 10:123667991-123668013 CTGTTGTCCCAGGGGAAGGCAGG + Intronic
1076878182 10:133227096-133227118 CGGTTGTCACAGGGTAAGACTGG + Intergenic
1077669612 11:4145603-4145625 CTGTGGTCTTTGGGTCAGACTGG + Intergenic
1078798273 11:14616012-14616034 CTGATTTCCATGGGTAAGGCAGG - Intronic
1079014985 11:16861200-16861222 CTGTTCTCCTGGGGAAAGAATGG - Intronic
1079110134 11:17600712-17600734 CTGTGGTCCCTGGGGCAGACAGG + Intronic
1080452520 11:32390294-32390316 CTGGTGTCCCAGGGTCAGACTGG + Intronic
1080787215 11:35486567-35486589 CTGCTGTCCTTGAGAAAGCCTGG + Intronic
1084608801 11:70187780-70187802 CTGATGTCCTTGGGGATGTCCGG - Exonic
1085235400 11:75010597-75010619 CTGTGATCCTTGGGAAAGCCAGG - Exonic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1089979707 11:122762192-122762214 CTGTTGTCCTTGGGTAAGACAGG + Intronic
1091848632 12:3677645-3677667 CTGTTGTCCTTGGAGAAGCTGGG + Intronic
1092708246 12:11308251-11308273 CTGTTGTCCCTGGGCAGGTCTGG + Exonic
1094463867 12:30729567-30729589 CTGTTGGACTTGCCTAAGACTGG + Intronic
1104012311 12:124940413-124940435 CTGGTATCCCTGGATAAGACAGG + Intergenic
1104679087 12:130736931-130736953 CTGTTCCCCTTGGGTGAGACAGG + Intergenic
1108675591 13:52735194-52735216 CTGTTTTCTTTGGCTGAGACGGG + Intronic
1110591325 13:77264734-77264756 CTGTGGTCCTTCTGTAATACTGG - Intronic
1111018377 13:82411454-82411476 CTGTTGTCCTTTTATGAGACAGG + Intergenic
1112078021 13:95934212-95934234 CTGTGGTCCATGAGTATGACTGG + Intronic
1113948250 13:114056992-114057014 CTGTTGTCCTTGGGAACCACGGG + Intronic
1114634243 14:24178421-24178443 CTGGTGCCCATGGGTATGACAGG - Intronic
1124050238 15:26190233-26190255 CTCTTGCCCTTGGGAATGACTGG + Intergenic
1125395297 15:39240830-39240852 CTGTTCTCCTTGGGTCTGACAGG - Intergenic
1127487442 15:59432404-59432426 GTGCTGTCCTTGGGGAAGACAGG + Intronic
1135966578 16:27040591-27040613 CAGGTGTCCTGGGGTCAGACAGG - Intergenic
1136641406 16:31568730-31568752 CTGTTGGGATGGGGTAAGACCGG + Intergenic
1137693607 16:50446704-50446726 CTGTGTTCCTTGGGTCAGGCAGG - Intergenic
1140596318 16:76419231-76419253 TTTTTTTCCTTAGGTAAGACAGG + Intronic
1141342362 16:83214641-83214663 CTGTTGTTAATGGGTAAGAATGG - Intronic
1143579802 17:7818835-7818857 CTGTTGTGCCTGGGGTAGACTGG - Intronic
1144913732 17:18704753-18704775 CTGGTCTCCTTGGGTAAGCTTGG + Intronic
1146629053 17:34457163-34457185 ATGTTGTCCTTGGAAAAGAGTGG - Intergenic
1147778383 17:42920558-42920580 CTGTTGTTGTTGGTTGAGACAGG + Intergenic
1155562668 18:27096076-27096098 CTGTTGTCCAAGAGTATGACTGG - Intronic
1155566383 18:27139796-27139818 TTATTTTCCTTGGTTAAGACTGG - Intronic
1156112875 18:33748544-33748566 CTGCTTTCCTCGGGTAAGGCTGG - Exonic
1156381437 18:36565056-36565078 CAGTTGCCCTTGGGGAAAACTGG + Intronic
1159089692 18:63833697-63833719 TTGTTTTCCTTGTATAAGACTGG + Intergenic
1162999244 19:14355842-14355864 TTGTGGGCCTTGGGGAAGACTGG + Intergenic
1163064889 19:14785510-14785532 TTGTGGGCCTTGGGGAAGACTGG - Intergenic
1164758450 19:30708517-30708539 CTGTTGTCCCTGGGGAGGACAGG + Intronic
926422648 2:12715413-12715435 GTGTCTTCCTGGGGTAAGACTGG + Intergenic
930308896 2:49713201-49713223 CAGTTGTCCTTGAATAAAACAGG + Intergenic
931774246 2:65526468-65526490 CTGTTGTCCTTTGGGAACAATGG + Intergenic
935606026 2:104972956-104972978 CTCTTGTCCATGGGAAAGAGGGG - Intergenic
942189512 2:173456353-173456375 CCGTAGCCCTTGGGGAAGACTGG + Intergenic
942273536 2:174301005-174301027 TTCTGGTCCTTGGGTGAGACAGG + Intergenic
946507598 2:220318120-220318142 CTGTATACTTTGGGTAAGACTGG + Intergenic
948702961 2:239772234-239772256 CTGTTGTCCCTGGGTACTCCTGG - Intronic
1176905317 21:14493373-14493395 CTATTGTCCTTGGGGAAAATGGG - Intronic
1180688739 22:17692146-17692168 CTGTTGTTCTTCTGTAAGAAGGG - Intronic
1184843801 22:47068333-47068355 CTGATGGCCTTTGGTAACACTGG - Intronic
951527067 3:23663693-23663715 TTTTTTTCCTTTGGTAAGACAGG - Intergenic
954100541 3:48369197-48369219 CTGTTGTCCCTGGCTCAGGCTGG - Intergenic
954106234 3:48411181-48411203 CTGCTGTCCCTGGGGAAGGCAGG - Intronic
955865387 3:63377035-63377057 CAGTTGTACTTGGGAAAAACGGG - Intronic
957405779 3:79774269-79774291 CTTTTGTTGTTGGGTCAGACAGG - Intergenic
959349395 3:105242218-105242240 CTGTTGTAATTGGTTAAAACTGG - Intergenic
969594774 4:8142803-8142825 GTGTTGTCCTTGGGGAGGGCAGG - Intronic
970843909 4:20512691-20512713 CTTTTGTCCTTCTGTATGACAGG - Intronic
971168855 4:24212811-24212833 CAGCTTTCCTTGGGTAAGAATGG - Intergenic
974193647 4:58540619-58540641 CTATTATCCTTGGGAAAGCCTGG + Intergenic
975585261 4:75941971-75941993 CAGTTGTCTGTGGGTAAAACAGG + Intronic
975699392 4:77048472-77048494 CTGTTGTCCTTGGAGAAGTCTGG + Exonic
977150853 4:93509729-93509751 CTGGGGTGCTTGGGTAAGGCAGG - Intronic
982591518 4:157318750-157318772 TTCTTGTTCTTGGGTGAGACAGG - Intronic
985268501 4:188172817-188172839 CTGTTGTTCTTGGGCCAGGCAGG + Intergenic
986394606 5:7316006-7316028 CTGTGATCCTTGGAAAAGACAGG - Intergenic
986631832 5:9781651-9781673 CTGTTGTCTTTTGGGAACACAGG - Intergenic
987715824 5:21568870-21568892 CTGTAGTGCTTGGGTAATGCTGG + Intergenic
988860772 5:35275793-35275815 CAGTTGCCCTTGGGTAAAAGGGG - Intergenic
991718389 5:69473236-69473258 CTTGTATCCTTGGGTAAGTCAGG + Intergenic
992263432 5:74993206-74993228 CTGATGACCCTGGGCAAGACAGG - Intergenic
993856785 5:93086273-93086295 CTGTTATACCTGGGTGAGACTGG + Intergenic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
1000246152 5:159450007-159450029 CTGGGGTCCTGGGGTAAGAGAGG + Intergenic
1000539241 5:162519872-162519894 CTGTGGACTTTGGGCAAGACAGG - Intergenic
1005195964 6:23284311-23284333 CTTTTGTCCTTGTGTAATATTGG + Intergenic
1005411874 6:25557886-25557908 CTGTTCTCCTTGTATAGGACAGG - Intronic
1009000898 6:57713181-57713203 CTGTAGTGCTTGGGTAAAGCTGG - Intergenic
1011800765 6:91013271-91013293 CTGGTGTCCTTTGTAAAGACAGG + Intergenic
1012823442 6:104118437-104118459 CAGTTGTCCTAGGGTCACACAGG + Intergenic
1013529399 6:111005041-111005063 CTATAGTCCTAGGGTCAGACTGG + Intronic
1013663996 6:112327990-112328012 CTTTTGTCCTTGGGTCCCACAGG - Intergenic
1014573370 6:123039498-123039520 CTGTTGTGCTTGATTGAGACTGG + Intronic
1018284712 6:162224941-162224963 CTGGTGTTCTTGGGAGAGACAGG + Intronic
1020279682 7:6643936-6643958 CTCGTGTCCTTGGGTAAGGACGG + Exonic
1023658694 7:42451738-42451760 CTGTTGTCATTGGGGAACCCTGG - Intergenic
1026442946 7:70459823-70459845 CTGTTGTCCTTGGCTTATCCCGG - Intronic
1029852470 7:103477828-103477850 ATCTTGTCCTTAGGTAAGATTGG - Intronic
1033151573 7:138919242-138919264 CTGTTTTCCTTGGTTAAAAAAGG + Exonic
1034207291 7:149329038-149329060 AGGTTGGCCTTGGGTAAGAATGG - Intergenic
1037870087 8:22486069-22486091 CTGTTTTAGTTGGGTATGACAGG + Intronic
1038321576 8:26531944-26531966 TTGGTGTCCTTTGGGAAGACAGG + Intronic
1040883419 8:52233493-52233515 CTGTTGTCATGGTGTAAGCCTGG + Intronic
1041025949 8:53687125-53687147 GTGTTATCCTTGGGGAAAACTGG + Intergenic
1045237119 8:100362218-100362240 CTATTGGACTTGGGTAGGACGGG + Intronic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1053409966 9:37909557-37909579 CTCTTGTCCTTGGGGCAGAAGGG + Intronic
1057190699 9:93085753-93085775 CAGTTCTCCTTGGCCAAGACAGG + Intergenic
1057350398 9:94292455-94292477 CTGGTCTCCCTGGGTAAGGCTGG + Exonic
1059826450 9:118034910-118034932 CTGTTGTTCTTGGTTAAGACTGG - Intergenic
1203779016 EBV:90448-90470 CTGTTGTCCTTGGTTAGCCCCGG + Intergenic
1187790723 X:22947189-22947211 CTGCTTTCCTTGGTCAAGACTGG + Intergenic
1190916245 X:54813193-54813215 GTGTTGTCCTTTGGCAAGAGAGG + Intronic
1190928117 X:54926658-54926680 GTGTTGTCCTTTGGCAAGAGAGG + Intronic
1195223289 X:102767012-102767034 GTGTTATCATTGGGTAAGAAAGG + Intergenic
1195681811 X:107552850-107552872 CTCTTGTCCTTGAGTATGCCGGG + Exonic
1195917349 X:109948617-109948639 TTGTTGATCTTGAGTAAGACTGG - Intergenic
1197083854 X:122449758-122449780 ATGTTGTCCTTTGGTGAGACAGG - Intergenic
1201585475 Y:15555814-15555836 CTCTGGTGCCTGGGTAAGACAGG - Intergenic