ID: 1089980024

View in Genome Browser
Species Human (GRCh38)
Location 11:122764599-122764621
Sequence TGACCTCTGTTGATGAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 152}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089980018_1089980024 1 Left 1089980018 11:122764575-122764597 CCCCAAGGCTTCCCAACACTTAC 0: 1
1: 0
2: 2
3: 6
4: 131
Right 1089980024 11:122764599-122764621 TGACCTCTGTTGATGAAAGGTGG 0: 1
1: 0
2: 2
3: 14
4: 152
1089980020_1089980024 -1 Left 1089980020 11:122764577-122764599 CCAAGGCTTCCCAACACTTACTT 0: 1
1: 0
2: 0
3: 15
4: 175
Right 1089980024 11:122764599-122764621 TGACCTCTGTTGATGAAAGGTGG 0: 1
1: 0
2: 2
3: 14
4: 152
1089980021_1089980024 -10 Left 1089980021 11:122764586-122764608 CCCAACACTTACTTGACCTCTGT 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1089980024 11:122764599-122764621 TGACCTCTGTTGATGAAAGGTGG 0: 1
1: 0
2: 2
3: 14
4: 152
1089980019_1089980024 0 Left 1089980019 11:122764576-122764598 CCCAAGGCTTCCCAACACTTACT 0: 1
1: 0
2: 1
3: 17
4: 204
Right 1089980024 11:122764599-122764621 TGACCTCTGTTGATGAAAGGTGG 0: 1
1: 0
2: 2
3: 14
4: 152
1089980015_1089980024 29 Left 1089980015 11:122764547-122764569 CCTTGGCTTGCGCAGCTCTTAGC 0: 1
1: 0
2: 2
3: 4
4: 161
Right 1089980024 11:122764599-122764621 TGACCTCTGTTGATGAAAGGTGG 0: 1
1: 0
2: 2
3: 14
4: 152
1089980017_1089980024 2 Left 1089980017 11:122764574-122764596 CCCCCAAGGCTTCCCAACACTTA 0: 1
1: 0
2: 1
3: 16
4: 168
Right 1089980024 11:122764599-122764621 TGACCTCTGTTGATGAAAGGTGG 0: 1
1: 0
2: 2
3: 14
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089980024 Original CRISPR TGACCTCTGTTGATGAAAGG TGG Intronic
903454678 1:23479045-23479067 TGACCTCTGCTGATGAAACCAGG + Intronic
903888754 1:26556118-26556140 AGGGCTCTGTTGATGAAATGAGG + Intronic
908074926 1:60506201-60506223 GTACCTCTGCTGATGAAAGGTGG + Intergenic
910143386 1:84051864-84051886 TGTCCTCACATGATGAAAGGGGG + Intergenic
910476243 1:87610646-87610668 TGACTTCCATTGATAAAAGGCGG + Intergenic
911251275 1:95579293-95579315 TGAACTCTGGTGATAAAAGGAGG + Intergenic
918904545 1:190475922-190475944 TGACTTCATTTGAAGAAAGGAGG - Intronic
921593079 1:217026042-217026064 TGACCTCAGTGGATAAAAGTGGG - Intronic
922287868 1:224184831-224184853 TAACCTCTGTTGAGGAAACGGGG + Intronic
1062798255 10:360294-360316 TGTCCCCTGTTGAAGAGAGGTGG + Intronic
1063983885 10:11480403-11480425 TGACCTCTTTTTATAGAAGGAGG + Intronic
1065136713 10:22678196-22678218 TCATTTCTGTTGTTGAAAGGGGG - Intronic
1066643958 10:37586205-37586227 TGACATCACTTGAAGAAAGGGGG - Intergenic
1067439277 10:46299532-46299554 TGTCCTCTCGTGATGAAGGGAGG - Intronic
1072331194 10:94353577-94353599 TGACCTCTGATGTTGGAAGTGGG - Intronic
1073126733 10:101155471-101155493 TGATCTCTGTGGATGATAGAAGG - Intergenic
1073729083 10:106269317-106269339 TGACCTCTATCCATGAAACGAGG - Intergenic
1074458521 10:113615811-113615833 TAATCTCTGTGGATGGAAGGAGG + Exonic
1074466076 10:113681967-113681989 TGCACTGTGATGATGAAAGGAGG + Intronic
1076015449 10:127024058-127024080 TGACCTCTGGTCATCAGAGGAGG - Intronic
1076484976 10:130810101-130810123 TGACCTCTGGTGATGCCAGAAGG + Intergenic
1077336659 11:2008155-2008177 TCACCTCTGTTCATGCCAGGAGG + Intergenic
1078355573 11:10629401-10629423 TGACCTCTGCTGAGGAGAGCAGG + Intronic
1079485972 11:20936197-20936219 TGTCCTCAGTTGGAGAAAGGGGG + Intronic
1083432707 11:62622595-62622617 TGTCATCTGTTGAAGAAATGTGG - Intergenic
1085259162 11:75194429-75194451 GGACCCCTGGTGATGAAAGCTGG - Intronic
1085339018 11:75719305-75719327 TGACGTTTGTTGTTGAAAGGAGG - Intronic
1086592127 11:88527394-88527416 TGACCTCTGTTTATGAAATATGG + Intronic
1086747734 11:90451354-90451376 TGACCTCTCTTACTGACAGGGGG - Intergenic
1089021469 11:115219724-115219746 TGGCCTCTGTCTCTGAAAGGGGG - Intronic
1089378920 11:118013833-118013855 TGACCACTGATGGTGAAGGGTGG + Intergenic
1089980024 11:122764599-122764621 TGACCTCTGTTGATGAAAGGTGG + Intronic
1090435029 11:126679470-126679492 TGACCTCTGTTTTATAAAGGAGG + Intronic
1090472441 11:126991978-126992000 TTACTTCTGCTGATGAAATGAGG + Intronic
1091017042 11:132060496-132060518 TGTCCTCCGCTGATGAAAGGAGG + Intronic
1091196758 11:133738295-133738317 TCACCTCAGATGAGGAAAGGAGG + Intergenic
1202819643 11_KI270721v1_random:63337-63359 TCACCTCTGTTCATGCCAGGAGG + Intergenic
1093518393 12:20018614-20018636 TGACGTCTGTTTATAATAGGAGG + Intergenic
1093594884 12:20948247-20948269 TGACCTCTGTTGTTGACATGTGG + Intergenic
1095368031 12:41431391-41431413 TGATCTCTATTGATGTAATGTGG - Intronic
1102629481 12:114265235-114265257 TGACCTCTGTTGATTAAACCTGG + Intergenic
1104045429 12:125159448-125159470 TGACCTTTGTACATCAAAGGAGG - Intergenic
1105625540 13:22109329-22109351 TGACGTCTGTTTAGGAAAGTAGG + Intergenic
1107187127 13:37536734-37536756 TGACCTCGCATGATGGAAGGTGG + Intergenic
1108383016 13:49872236-49872258 GGAGCTCTGGTGATGGAAGGAGG + Intergenic
1110103785 13:71644499-71644521 TGAACTCTGTTGGTGACAGGAGG - Intronic
1110732618 13:78896654-78896676 TGACATATTTTTATGAAAGGGGG + Intergenic
1111144007 13:84157160-84157182 TGAGCTATGTCCATGAAAGGTGG + Intergenic
1114596622 14:23917705-23917727 TGACCTCTGGAGAGGAAAGGAGG + Intergenic
1115465802 14:33712940-33712962 TGCCTCCTGTTGATGAGAGGAGG - Intronic
1115850879 14:37588941-37588963 TCACTTCAGTTAATGAAAGGAGG - Intergenic
1116552199 14:46255396-46255418 TGACATCTGTAGATTAAATGTGG + Intergenic
1117971542 14:61255606-61255628 TGAGCTCTGCAGATGAAAGGTGG - Intronic
1118334884 14:64844446-64844468 AGAGCACTGATGATGAAAGGAGG - Intronic
1118613147 14:67556953-67556975 TGACCTCTGTGGATCCCAGGAGG - Intronic
1119170159 14:72528894-72528916 TGACCTCTGCTGATTTATGGGGG - Intronic
1120001066 14:79303588-79303610 TGACCTCAGTTGATCACAAGAGG - Intronic
1124573557 15:30887353-30887375 TGTCCTCACTTGATGAAAGCAGG + Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1129605407 15:77022670-77022692 TCAGCTCTGTGGATGAGAGGAGG - Intronic
1135091109 16:19518590-19518612 TTACCTCTGGAGAGGAAAGGAGG - Intronic
1135828474 16:25751873-25751895 AGACCACAGTGGATGAAAGGAGG + Intronic
1136061529 16:27729957-27729979 AAACCTCTGCTGATGAGAGGAGG - Intronic
1136550184 16:30978963-30978985 TGAACTCCCTTGATGAGAGGGGG - Intronic
1138990462 16:62385182-62385204 GGACATGTGTTGATGAAAAGAGG + Intergenic
1141142569 16:81506368-81506390 TGACCTCTGTTCTTAAGAGGTGG + Intronic
1142603268 17:1067661-1067683 TGACCACTCTTGATAAGAGGTGG - Intronic
1144464804 17:15488768-15488790 TGACAGCTGTTGATGACAGCTGG - Intronic
1145942568 17:28750276-28750298 TGCCCTCTGCCGATGAAATGCGG + Exonic
1146194853 17:30802750-30802772 AGATCTCTGTTGAAGGAAGGTGG + Intronic
1148055229 17:44790410-44790432 TGACCAGTGTTGTTGAAAAGAGG + Intergenic
1149412518 17:56423431-56423453 TGACCAGTGTTGGTGTAAGGAGG - Intronic
1150501444 17:65654533-65654555 CGACCTCTGTTGTTTGAAGGTGG + Intronic
1153490275 18:5640259-5640281 GGACCTCTCTGGATGAAATGCGG - Intergenic
1155839934 18:30631818-30631840 TGACCTCTATCCATGAAATGGGG + Intergenic
1158488233 18:57887366-57887388 TGACCTATGCAGATGAGAGGTGG + Intergenic
1161344852 19:3763311-3763333 TGATCTCCTTTGTTGAAAGGGGG + Intronic
1163331376 19:16640394-16640416 TTTCCTATGTTGATGAAAGACGG - Intronic
1165148236 19:33745725-33745747 TGACCTGAATTGATGCAAGGGGG + Intronic
1168618787 19:57860097-57860119 TGAACTCTGATGATGAAGGAGGG - Exonic
1168624723 19:57908571-57908593 TGAACTCTGATGATGAAGGAGGG + Exonic
925919222 2:8627834-8627856 TGGCCTCCGCTGATGTAAGGAGG + Intergenic
929326615 2:40619669-40619691 TTACATCTTTTGATGAAAGAAGG - Intergenic
930281730 2:49377520-49377542 TAATCTCTGTTGCTGACAGGTGG - Intergenic
931596879 2:63956779-63956801 TGTCCTCTGTTGTAGAATGGCGG + Intronic
932182587 2:69662085-69662107 TGACCTTTCTTGATGCCAGGTGG - Intronic
932190601 2:69738858-69738880 TGACCTTTCTTGATGCCAGGTGG + Intronic
932604897 2:73158372-73158394 TGACCAGTGTTCAAGAAAGGTGG + Intergenic
935394542 2:102592792-102592814 TGACCTCTGTTGATGAAACCAGG + Intergenic
944319626 2:198323509-198323531 TTTCTTCTGTTCATGAAAGGAGG - Intronic
945369964 2:209004379-209004401 TGACCTCTATCCATGAAATGAGG - Intergenic
945720942 2:213417829-213417851 TGATCTTTGTTTATAAAAGGAGG - Intronic
946020588 2:216637266-216637288 TCACCACTGTTCATGAAAGAAGG + Intronic
946314170 2:218898402-218898424 CGCCCTCTGTTGGTGAGAGGCGG + Intronic
1170210859 20:13845207-13845229 TGACCTCTGTTTAACACAGGAGG - Intergenic
1170605214 20:17870412-17870434 TGACAACTGTTCATGAAATGGGG - Intergenic
1171812876 20:29759618-29759640 GGACCTCTGTTCTTGAAAGCGGG - Intergenic
1175369667 20:58479747-58479769 TAACCTCTCTTGATTAGAGGAGG + Intronic
1178327307 21:31656424-31656446 GGACCTCTGTGGTTAAAAGGTGG - Intergenic
1178672061 21:34600235-34600257 TGACCTTTCTTAATGAAAGTAGG - Intronic
949919267 3:8988459-8988481 TGACCTCTGTTAGTGAAAGGGGG + Intronic
950797458 3:15521534-15521556 AGAACGCTGTTGATGAAAGTCGG + Exonic
950802316 3:15563253-15563275 AGACCTCTGTGGATGATAGAGGG + Intronic
951356679 3:21675569-21675591 TGCCCTTTTTTGATGAAAGGTGG + Intronic
954083998 3:48229703-48229725 TCACCTCTGTTGATGATGTGAGG + Intergenic
957227330 3:77466725-77466747 TCACCCCTGCTGATGAAATGAGG - Intronic
957321799 3:78640762-78640784 TCACCTCTTTTGCTGAATGGAGG - Intronic
959322841 3:104900807-104900829 TGACCTCTGTGGATGAACTAGGG - Intergenic
962444974 3:135456015-135456037 AGACCTCTGTTTCTGAAATGAGG - Intergenic
966134705 3:176684977-176684999 TGACCTTTGATGGTGAAAGCTGG - Intergenic
966260674 3:177974918-177974940 TGACCTCTGTTAAACTAAGGTGG - Intergenic
966928975 3:184663593-184663615 GAACCTCTCTTTATGAAAGGCGG - Intronic
968193498 3:196688397-196688419 TGAGCTATGATGATGAAATGAGG - Intronic
968241678 3:197094190-197094212 TGACCTCAGTTGATGCCAGAAGG + Intronic
969691792 4:8707924-8707946 TGACCTCAGTGTATGATAGGGGG - Intergenic
971627460 4:28940495-28940517 TGACCTCTGTTAAAGAAAATGGG + Intergenic
978888158 4:113790710-113790732 TGAACTTTGATGATGAAAGAGGG + Intergenic
980646570 4:135651272-135651294 TGGCCACTGTTGAAGAATGGAGG - Intergenic
981010490 4:139920635-139920657 TGCCCTCCATTAATGAAAGGTGG - Intronic
981552360 4:145954932-145954954 TCACCTTCGTTCATGAAAGGAGG + Intergenic
987676130 5:21075035-21075057 TGATCTCTTTTGATGAGAGAGGG - Intergenic
989285999 5:39700475-39700497 TTACCTGTGTTGAACAAAGGAGG + Intergenic
990246607 5:53869519-53869541 TGACCCCTCTTGCTGAAAAGAGG - Intergenic
992895801 5:81244170-81244192 TGACTTCTGTTAGTGAAAAGTGG - Exonic
993811757 5:92488315-92488337 TGAGCTCTGTAGTTGATAGGTGG - Intergenic
995320190 5:110825110-110825132 TGAACTCTGTCTATGAAATGGGG - Intergenic
998487425 5:142515157-142515179 TGACCTCTGTGTATGAAACCAGG - Intergenic
999106018 5:149071853-149071875 TGACCTCTGGGGAAGAGAGGGGG + Intergenic
1000030142 5:157394474-157394496 TGTCCTCCGGTGAGGAAAGGGGG + Intronic
1001324031 5:170706915-170706937 TGACCTGTGTTGAAGAGAGAGGG - Intronic
1003954552 6:11149723-11149745 TGAGCCTTGTTTATGAAAGGTGG - Intergenic
1005323779 6:24680202-24680224 TGACCTCTTCTGTAGAAAGGAGG - Intronic
1007157193 6:39756960-39756982 TGACATCTGTTAAGGAAAGAGGG - Intergenic
1010366825 6:75060636-75060658 TTACCTCTGTGGAGGAAATGAGG - Intergenic
1011221779 6:85062208-85062230 TGCCCCCTGATGAGGAAAGGTGG + Intergenic
1011806599 6:91079572-91079594 TAAACTCTATTAATGAAAGGTGG + Intergenic
1011968632 6:93192926-93192948 TTACCTCTGATGATGTAAGAAGG - Intergenic
1015862726 6:137697558-137697580 TGACAGCTGTTGATGACAAGAGG + Intergenic
1017273468 6:152537069-152537091 TTAGCTCTGTTAATGAAAGAAGG - Intronic
1018779662 6:167051234-167051256 TGACCTCTGTAGAAAATAGGTGG + Exonic
1019076581 6:169393202-169393224 TGACCTCTATCCATGAAATGGGG + Intergenic
1019162420 6:170077712-170077734 TGTCCTCTGGTGGTGAAGGGAGG + Intergenic
1021824238 7:24532086-24532108 TTAGCCCTGTTGATGCAAGGGGG - Intergenic
1023950252 7:44838361-44838383 TGGCCTCTTTTAATAAAAGGTGG + Intronic
1024696157 7:51858685-51858707 TGTCCTCTGCTGATAACAGGTGG - Intergenic
1027436992 7:78174797-78174819 TGGCCTCTGAGGAAGAAAGGGGG + Intronic
1027922524 7:84413038-84413060 TTGCATTTGTTGATGAAAGGTGG - Intronic
1029061263 7:97800222-97800244 TGACCACTGTGGATGGAAAGTGG - Intergenic
1031386525 7:121158431-121158453 TGTGCTCTGGTTATGAAAGGGGG - Intronic
1035235849 7:157497269-157497291 TGACCTCTGTTTCTGAAGGTTGG + Intergenic
1035243641 7:157548471-157548493 TGACCTCTGTTGCTGCAAACTGG + Intronic
1037386100 8:18343824-18343846 TGATCTCTGTTGTTGGAAGTGGG + Intergenic
1039280495 8:35979096-35979118 TGGCTTCAGTTGAGGAAAGGGGG + Intergenic
1040928673 8:52712670-52712692 AAACCTCTGTTGATGGAAAGTGG - Intronic
1045759188 8:105583697-105583719 ACACTTCTTTTGATGAAAGGTGG + Intronic
1049876784 8:145028494-145028516 GGACCTCTGTTCTTGAAAGCTGG - Intergenic
1051462029 9:17330049-17330071 TGACTTCTGTTGTTAAAATGTGG + Intronic
1053628612 9:39904555-39904577 TTTCCCCTGTTGATGACAGGGGG - Intergenic
1054215275 9:62346147-62346169 TTTCCCCTGTTGATGACAGGGGG + Intergenic
1054672206 9:67809202-67809224 TTTCCCCTGTTGATGACAGGGGG - Intergenic
1055734188 9:79310260-79310282 TGGCCCCTGTACATGAAAGGAGG - Intergenic
1056378150 9:86034363-86034385 TGACCTCATTTGAAGAAACGCGG - Intronic
1057511640 9:95684742-95684764 TGTCCTCTGTAGATCAAAGAAGG - Intergenic
1058475383 9:105327711-105327733 TAACCAGTGTGGATGAAAGGGGG - Intronic
1061135927 9:128733495-128733517 TGCCCTCTGCTGATCAAAGAAGG - Exonic
1188991778 X:36829800-36829822 TGATTTCTGTTGATTAAAAGTGG + Intergenic
1193042447 X:77017798-77017820 TGACCTCTCATGATGAAGGGAGG - Intergenic
1197312963 X:124928853-124928875 AGACGTGTGATGATGAAAGGTGG - Intronic
1201399796 Y:13593087-13593109 TGACCTTTCTTGAGGAAATGGGG + Intergenic