ID: 1089986145

View in Genome Browser
Species Human (GRCh38)
Location 11:122815972-122815994
Sequence CCAGGGGAATCTGAACACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089986145_1089986153 4 Left 1089986145 11:122815972-122815994 CCTGTGTGTTCAGATTCCCCTGG No data
Right 1089986153 11:122815999-122816021 CCCTCTGTCTTCAGAGATGAGGG No data
1089986145_1089986151 3 Left 1089986145 11:122815972-122815994 CCTGTGTGTTCAGATTCCCCTGG No data
Right 1089986151 11:122815998-122816020 TCCCTCTGTCTTCAGAGATGAGG No data
1089986145_1089986156 28 Left 1089986145 11:122815972-122815994 CCTGTGTGTTCAGATTCCCCTGG No data
Right 1089986156 11:122816023-122816045 GCTCATTTTCTCCCGCTCTAGGG No data
1089986145_1089986155 27 Left 1089986145 11:122815972-122815994 CCTGTGTGTTCAGATTCCCCTGG No data
Right 1089986155 11:122816022-122816044 TGCTCATTTTCTCCCGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089986145 Original CRISPR CCAGGGGAATCTGAACACAC AGG (reversed) Intergenic
No off target data available for this crispr