ID: 1089986148

View in Genome Browser
Species Human (GRCh38)
Location 11:122815988-122816010
Sequence GAAGACAGAGGGACACCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089986148_1089986155 11 Left 1089986148 11:122815988-122816010 CCCCTGGGTGTCCCTCTGTCTTC No data
Right 1089986155 11:122816022-122816044 TGCTCATTTTCTCCCGCTCTAGG No data
1089986148_1089986157 16 Left 1089986148 11:122815988-122816010 CCCCTGGGTGTCCCTCTGTCTTC No data
Right 1089986157 11:122816027-122816049 ATTTTCTCCCGCTCTAGGGAAGG No data
1089986148_1089986156 12 Left 1089986148 11:122815988-122816010 CCCCTGGGTGTCCCTCTGTCTTC No data
Right 1089986156 11:122816023-122816045 GCTCATTTTCTCCCGCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089986148 Original CRISPR GAAGACAGAGGGACACCCAG GGG (reversed) Intergenic
No off target data available for this crispr