ID: 1089986149

View in Genome Browser
Species Human (GRCh38)
Location 11:122815989-122816011
Sequence TGAAGACAGAGGGACACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089986149_1089986157 15 Left 1089986149 11:122815989-122816011 CCCTGGGTGTCCCTCTGTCTTCA No data
Right 1089986157 11:122816027-122816049 ATTTTCTCCCGCTCTAGGGAAGG No data
1089986149_1089986156 11 Left 1089986149 11:122815989-122816011 CCCTGGGTGTCCCTCTGTCTTCA No data
Right 1089986156 11:122816023-122816045 GCTCATTTTCTCCCGCTCTAGGG No data
1089986149_1089986155 10 Left 1089986149 11:122815989-122816011 CCCTGGGTGTCCCTCTGTCTTCA No data
Right 1089986155 11:122816022-122816044 TGCTCATTTTCTCCCGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089986149 Original CRISPR TGAAGACAGAGGGACACCCA GGG (reversed) Intergenic