ID: 1089986152

View in Genome Browser
Species Human (GRCh38)
Location 11:122815999-122816021
Sequence CCCTCATCTCTGAAGACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089986152_1089986156 1 Left 1089986152 11:122815999-122816021 CCCTCTGTCTTCAGAGATGAGGG No data
Right 1089986156 11:122816023-122816045 GCTCATTTTCTCCCGCTCTAGGG No data
1089986152_1089986157 5 Left 1089986152 11:122815999-122816021 CCCTCTGTCTTCAGAGATGAGGG No data
Right 1089986157 11:122816027-122816049 ATTTTCTCCCGCTCTAGGGAAGG No data
1089986152_1089986155 0 Left 1089986152 11:122815999-122816021 CCCTCTGTCTTCAGAGATGAGGG No data
Right 1089986155 11:122816022-122816044 TGCTCATTTTCTCCCGCTCTAGG No data
1089986152_1089986160 29 Left 1089986152 11:122815999-122816021 CCCTCTGTCTTCAGAGATGAGGG No data
Right 1089986160 11:122816051-122816073 ACCTTTCACATGAAGTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089986152 Original CRISPR CCCTCATCTCTGAAGACAGA GGG (reversed) Intergenic