ID: 1089986154

View in Genome Browser
Species Human (GRCh38)
Location 11:122816000-122816022
Sequence ACCCTCATCTCTGAAGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089986154_1089986157 4 Left 1089986154 11:122816000-122816022 CCTCTGTCTTCAGAGATGAGGGT No data
Right 1089986157 11:122816027-122816049 ATTTTCTCCCGCTCTAGGGAAGG No data
1089986154_1089986160 28 Left 1089986154 11:122816000-122816022 CCTCTGTCTTCAGAGATGAGGGT No data
Right 1089986160 11:122816051-122816073 ACCTTTCACATGAAGTTCTCAGG No data
1089986154_1089986156 0 Left 1089986154 11:122816000-122816022 CCTCTGTCTTCAGAGATGAGGGT No data
Right 1089986156 11:122816023-122816045 GCTCATTTTCTCCCGCTCTAGGG No data
1089986154_1089986155 -1 Left 1089986154 11:122816000-122816022 CCTCTGTCTTCAGAGATGAGGGT No data
Right 1089986155 11:122816022-122816044 TGCTCATTTTCTCCCGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089986154 Original CRISPR ACCCTCATCTCTGAAGACAG AGG (reversed) Intergenic