ID: 1089986155

View in Genome Browser
Species Human (GRCh38)
Location 11:122816022-122816044
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089986149_1089986155 10 Left 1089986149 11:122815989-122816011 CCCTGGGTGTCCCTCTGTCTTCA No data
Right 1089986155 11:122816022-122816044 TGCTCATTTTCTCCCGCTCTAGG No data
1089986154_1089986155 -1 Left 1089986154 11:122816000-122816022 CCTCTGTCTTCAGAGATGAGGGT No data
Right 1089986155 11:122816022-122816044 TGCTCATTTTCTCCCGCTCTAGG No data
1089986148_1089986155 11 Left 1089986148 11:122815988-122816010 CCCCTGGGTGTCCCTCTGTCTTC No data
Right 1089986155 11:122816022-122816044 TGCTCATTTTCTCCCGCTCTAGG No data
1089986152_1089986155 0 Left 1089986152 11:122815999-122816021 CCCTCTGTCTTCAGAGATGAGGG No data
Right 1089986155 11:122816022-122816044 TGCTCATTTTCTCCCGCTCTAGG No data
1089986150_1089986155 9 Left 1089986150 11:122815990-122816012 CCTGGGTGTCCCTCTGTCTTCAG No data
Right 1089986155 11:122816022-122816044 TGCTCATTTTCTCCCGCTCTAGG No data
1089986145_1089986155 27 Left 1089986145 11:122815972-122815994 CCTGTGTGTTCAGATTCCCCTGG No data
Right 1089986155 11:122816022-122816044 TGCTCATTTTCTCCCGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089986155 Original CRISPR TGCTCATTTTCTCCCGCTCT AGG Intergenic
No off target data available for this crispr