ID: 1089986160

View in Genome Browser
Species Human (GRCh38)
Location 11:122816051-122816073
Sequence ACCTTTCACATGAAGTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089986152_1089986160 29 Left 1089986152 11:122815999-122816021 CCCTCTGTCTTCAGAGATGAGGG No data
Right 1089986160 11:122816051-122816073 ACCTTTCACATGAAGTTCTCAGG No data
1089986158_1089986160 -6 Left 1089986158 11:122816034-122816056 CCCGCTCTAGGGAAGGCACCTTT No data
Right 1089986160 11:122816051-122816073 ACCTTTCACATGAAGTTCTCAGG No data
1089986154_1089986160 28 Left 1089986154 11:122816000-122816022 CCTCTGTCTTCAGAGATGAGGGT No data
Right 1089986160 11:122816051-122816073 ACCTTTCACATGAAGTTCTCAGG No data
1089986159_1089986160 -7 Left 1089986159 11:122816035-122816057 CCGCTCTAGGGAAGGCACCTTTC No data
Right 1089986160 11:122816051-122816073 ACCTTTCACATGAAGTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089986160 Original CRISPR ACCTTTCACATGAAGTTCTC AGG Intergenic
No off target data available for this crispr