ID: 1089993487

View in Genome Browser
Species Human (GRCh38)
Location 11:122883068-122883090
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 196}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089993487_1089993499 15 Left 1089993487 11:122883068-122883090 CCAAGCAAGCTGGGGAGGAGCCG 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1089993499 11:122883106-122883128 GGACGGAGTGGGGAGCGACAAGG 0: 1
1: 0
2: 0
3: 20
4: 270
1089993487_1089993500 16 Left 1089993487 11:122883068-122883090 CCAAGCAAGCTGGGGAGGAGCCG 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1089993500 11:122883107-122883129 GACGGAGTGGGGAGCGACAAGGG 0: 1
1: 0
2: 0
3: 8
4: 133
1089993487_1089993503 23 Left 1089993487 11:122883068-122883090 CCAAGCAAGCTGGGGAGGAGCCG 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1089993503 11:122883114-122883136 TGGGGAGCGACAAGGGGGCGAGG 0: 1
1: 0
2: 0
3: 21
4: 284
1089993487_1089993494 -2 Left 1089993487 11:122883068-122883090 CCAAGCAAGCTGGGGAGGAGCCG 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1089993494 11:122883089-122883111 CGGCGCGGGAGCCTTCGGGACGG 0: 1
1: 0
2: 0
3: 8
4: 101
1089993487_1089993497 5 Left 1089993487 11:122883068-122883090 CCAAGCAAGCTGGGGAGGAGCCG 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1089993497 11:122883096-122883118 GGAGCCTTCGGGACGGAGTGGGG 0: 1
1: 0
2: 1
3: 8
4: 136
1089993487_1089993496 4 Left 1089993487 11:122883068-122883090 CCAAGCAAGCTGGGGAGGAGCCG 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1089993496 11:122883095-122883117 GGGAGCCTTCGGGACGGAGTGGG 0: 1
1: 0
2: 1
3: 5
4: 104
1089993487_1089993492 -6 Left 1089993487 11:122883068-122883090 CCAAGCAAGCTGGGGAGGAGCCG 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1089993492 11:122883085-122883107 GAGCCGGCGCGGGAGCCTTCGGG 0: 1
1: 0
2: 0
3: 9
4: 116
1089993487_1089993501 17 Left 1089993487 11:122883068-122883090 CCAAGCAAGCTGGGGAGGAGCCG 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1089993501 11:122883108-122883130 ACGGAGTGGGGAGCGACAAGGGG 0: 1
1: 0
2: 0
3: 6
4: 137
1089993487_1089993495 3 Left 1089993487 11:122883068-122883090 CCAAGCAAGCTGGGGAGGAGCCG 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1089993495 11:122883094-122883116 CGGGAGCCTTCGGGACGGAGTGG 0: 1
1: 0
2: 1
3: 6
4: 88
1089993487_1089993491 -7 Left 1089993487 11:122883068-122883090 CCAAGCAAGCTGGGGAGGAGCCG 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1089993491 11:122883084-122883106 GGAGCCGGCGCGGGAGCCTTCGG 0: 1
1: 0
2: 4
3: 20
4: 175
1089993487_1089993502 18 Left 1089993487 11:122883068-122883090 CCAAGCAAGCTGGGGAGGAGCCG 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1089993502 11:122883109-122883131 CGGAGTGGGGAGCGACAAGGGGG 0: 1
1: 0
2: 0
3: 15
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089993487 Original CRISPR CGGCTCCTCCCCAGCTTGCT TGG (reversed) Intronic